ID: 1065841471

View in Genome Browser
Species Human (GRCh38)
Location 10:29704819-29704841
Sequence TGTCTGCATGTCTTTTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 358}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065841471_1065841487 19 Left 1065841471 10:29704819-29704841 CCAAACCAAAAGACATGCAGACA 0: 1
1: 0
2: 1
3: 23
4: 358
Right 1065841487 10:29704861-29704883 ATTTTCAGGGGGTTGGGGAAGGG No data
1065841471_1065841489 26 Left 1065841471 10:29704819-29704841 CCAAACCAAAAGACATGCAGACA 0: 1
1: 0
2: 1
3: 23
4: 358
Right 1065841489 10:29704868-29704890 GGGGGTTGGGGAAGGGAACAGGG No data
1065841471_1065841479 6 Left 1065841471 10:29704819-29704841 CCAAACCAAAAGACATGCAGACA 0: 1
1: 0
2: 1
3: 23
4: 358
Right 1065841479 10:29704848-29704870 AGGAGTCCTGGGGATTTTCAGGG No data
1065841471_1065841474 -6 Left 1065841471 10:29704819-29704841 CCAAACCAAAAGACATGCAGACA 0: 1
1: 0
2: 1
3: 23
4: 358
Right 1065841474 10:29704836-29704858 CAGACACCTCTCAGGAGTCCTGG No data
1065841471_1065841488 25 Left 1065841471 10:29704819-29704841 CCAAACCAAAAGACATGCAGACA 0: 1
1: 0
2: 1
3: 23
4: 358
Right 1065841488 10:29704867-29704889 AGGGGGTTGGGGAAGGGAACAGG No data
1065841471_1065841486 18 Left 1065841471 10:29704819-29704841 CCAAACCAAAAGACATGCAGACA 0: 1
1: 0
2: 1
3: 23
4: 358
Right 1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG No data
1065841471_1065841484 13 Left 1065841471 10:29704819-29704841 CCAAACCAAAAGACATGCAGACA 0: 1
1: 0
2: 1
3: 23
4: 358
Right 1065841484 10:29704855-29704877 CTGGGGATTTTCAGGGGGTTGGG No data
1065841471_1065841478 5 Left 1065841471 10:29704819-29704841 CCAAACCAAAAGACATGCAGACA 0: 1
1: 0
2: 1
3: 23
4: 358
Right 1065841478 10:29704847-29704869 CAGGAGTCCTGGGGATTTTCAGG No data
1065841471_1065841475 -5 Left 1065841471 10:29704819-29704841 CCAAACCAAAAGACATGCAGACA 0: 1
1: 0
2: 1
3: 23
4: 358
Right 1065841475 10:29704837-29704859 AGACACCTCTCAGGAGTCCTGGG No data
1065841471_1065841483 12 Left 1065841471 10:29704819-29704841 CCAAACCAAAAGACATGCAGACA 0: 1
1: 0
2: 1
3: 23
4: 358
Right 1065841483 10:29704854-29704876 CCTGGGGATTTTCAGGGGGTTGG No data
1065841471_1065841480 7 Left 1065841471 10:29704819-29704841 CCAAACCAAAAGACATGCAGACA 0: 1
1: 0
2: 1
3: 23
4: 358
Right 1065841480 10:29704849-29704871 GGAGTCCTGGGGATTTTCAGGGG No data
1065841471_1065841481 8 Left 1065841471 10:29704819-29704841 CCAAACCAAAAGACATGCAGACA 0: 1
1: 0
2: 1
3: 23
4: 358
Right 1065841481 10:29704850-29704872 GAGTCCTGGGGATTTTCAGGGGG No data
1065841471_1065841485 14 Left 1065841471 10:29704819-29704841 CCAAACCAAAAGACATGCAGACA 0: 1
1: 0
2: 1
3: 23
4: 358
Right 1065841485 10:29704856-29704878 TGGGGATTTTCAGGGGGTTGGGG No data
1065841471_1065841476 -4 Left 1065841471 10:29704819-29704841 CCAAACCAAAAGACATGCAGACA 0: 1
1: 0
2: 1
3: 23
4: 358
Right 1065841476 10:29704838-29704860 GACACCTCTCAGGAGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065841471 Original CRISPR TGTCTGCATGTCTTTTGGTT TGG (reversed) Intronic
900282325 1:1878776-1878798 TGTCTGCATGGATTTTAGATGGG - Intronic
901124618 1:6920306-6920328 TGACTGCATGTCTTGTGTCTGGG + Intronic
902794852 1:18794469-18794491 TGTGTTTCTGTCTTTTGGTTTGG + Intergenic
905077118 1:35282355-35282377 TGTCTGCTTAGCTTTTGGTGAGG - Intronic
906217262 1:44050339-44050361 GGTCAGCATGTCTTTTGGAGAGG - Intergenic
906740728 1:48181330-48181352 CTACTGCATGTCTTTTGGCTAGG - Intergenic
906757368 1:48330924-48330946 TCTCTGCATTTCTTTTGTTGGGG - Intronic
906834121 1:49064659-49064681 TGTCTCCAATTATTTTGGTTAGG - Intronic
906846277 1:49196501-49196523 TTTCAGAATTTCTTTTGGTTAGG + Intronic
907548727 1:55286079-55286101 TGTCTGCATGGGCTTTGGATGGG + Intergenic
907658514 1:56370053-56370075 TTTCTGCTTGTCTCTCGGTTTGG + Intergenic
908427115 1:64018011-64018033 TGCCTGTGTGTCTTTTAGTTTGG + Intronic
909557935 1:76975644-76975666 TGTCTGCTTTTCTTTTGGGAGGG - Intronic
910215738 1:84842351-84842373 TGACTGAATTTCTTTTGTTTGGG - Intronic
910368780 1:86494165-86494187 TGTTTACATGTGTTTTGGTCAGG + Exonic
911076457 1:93880140-93880162 TGTGTGCATGTCTTTAGGGACGG + Intergenic
911500966 1:98683808-98683830 GGTTTGCATGTCTTTTAGTCTGG + Intronic
911713512 1:101102505-101102527 TGTCTGCAGTTCTTTTGCATTGG + Intergenic
911727689 1:101259115-101259137 TGTCTGTCTGTCTGTTGATTTGG + Intergenic
911778324 1:101843221-101843243 TGTGGGCATGTCATTTGTTTTGG - Intronic
911801931 1:102151575-102151597 TGTTTGCCTGTCTTATGATTTGG - Intergenic
916597246 1:166256553-166256575 TGTCTGCATATCTGGTGGTGTGG + Intergenic
917079006 1:171237412-171237434 AGTCTGCATGTCCTGGGGTTGGG - Intergenic
918490563 1:185076902-185076924 TGTCTGCTGGTATTTTGATTGGG + Intronic
920009314 1:202856379-202856401 TTTCTGTATCTCTGTTGGTTTGG - Intergenic
922714142 1:227857848-227857870 TGACTGCATTTCTTTTTGTTAGG - Intergenic
924269976 1:242322100-242322122 TGTCTGCATGTGTGATGGGTGGG + Intronic
924278094 1:242408620-242408642 TGTCTGCTTGGCTTCTGGTGAGG - Intronic
1064480029 10:15730369-15730391 CATCTGCATGCATTTTGGTTGGG + Intergenic
1065149476 10:22807699-22807721 TGTTTCCATTTCTTTTGGGTAGG + Intergenic
1065841471 10:29704819-29704841 TGTCTGCATGTCTTTTGGTTTGG - Intronic
1067023753 10:42826268-42826290 TGTGTGTGTGTGTTTTGGTTTGG + Intronic
1067171052 10:43906318-43906340 TGTCAGCATGTAGTTTGCTTAGG - Intergenic
1068377950 10:56209479-56209501 TGTCTGTATTTCTTTGGGGTTGG + Intergenic
1068996215 10:63207883-63207905 TGCCTGGGAGTCTTTTGGTTCGG + Exonic
1069297220 10:66861329-66861351 TGTCTGCATGTGTTTTCTCTGGG + Intronic
1069376640 10:67799913-67799935 TGTCTGCATGTCTATTTCTACGG - Intronic
1070385693 10:75922304-75922326 TGACAGCATGAGTTTTGGTTTGG + Intronic
1070426173 10:76289831-76289853 TGACTTCATGTCTTTAGGTTTGG + Intronic
1071841283 10:89474318-89474340 TGCATGCATGTATTTTGTTTGGG - Intronic
1071846228 10:89524000-89524022 TGTCTGGATGTCTTTTCCTGAGG - Intronic
1071883966 10:89929629-89929651 TGTCTGCATCTCTTGTAGTTTGG + Intergenic
1073788923 10:106920148-106920170 TGTCTGCATTTCTCTTCATTGGG - Intronic
1074003136 10:109392392-109392414 TGTGTACATGTCTTTTGTGTGGG - Intergenic
1075833479 10:125431290-125431312 TTTCTGCCTGTTTTTTGGCTAGG - Intergenic
1076467751 10:130696794-130696816 TGTATGCCTGTGTCTTGGTTTGG + Intergenic
1077364944 11:2157864-2157886 TGGCTGCATCTCTTTTGGGTGGG + Intronic
1078769626 11:14336370-14336392 TGTCTTTTTGTCATTTGGTTTGG - Intronic
1078779982 11:14428630-14428652 TGTTTTCATTTATTTTGGTTAGG - Intergenic
1079276493 11:19042155-19042177 TCACTGCATGTCTTTTAATTGGG - Intergenic
1080775225 11:35379845-35379867 TGTCTGGATGACATTTGTTTTGG - Intronic
1081458639 11:43250372-43250394 TGGCTGCATTTCTTTTGCTATGG - Intergenic
1081974870 11:47227027-47227049 TGTTTGCCTGTTTTTTAGTTGGG + Intronic
1083094058 11:60231766-60231788 TCTAAGCATGTCTTTTTGTTGGG - Intronic
1083136430 11:60681307-60681329 TGTTTGCATGTGTTTGTGTTGGG - Intergenic
1083246446 11:61431663-61431685 CCACTTCATGTCTTTTGGTTGGG + Intronic
1085244261 11:75086254-75086276 AATCTGCATGACCTTTGGTTTGG + Intergenic
1085645827 11:78221958-78221980 TGTCTCGATGTCTTGTGGCTTGG - Intronic
1085908574 11:80794418-80794440 TGTAAGCAGGTCTTTAGGTTTGG - Intergenic
1087017915 11:93572620-93572642 TCTCTCCATGTCTTTTTTTTTGG - Intergenic
1088342582 11:108785571-108785593 CGTCTGGAGCTCTTTTGGTTTGG + Intronic
1090725372 11:129521024-129521046 TGTGTGTCTGTGTTTTGGTTTGG + Intergenic
1091332274 11:134739279-134739301 TGTCTGCGTGTGGTTTGGGTTGG + Intergenic
1092099835 12:5873939-5873961 TCTCTGCGCGTCTCTTGGTTGGG - Intronic
1093514716 12:19972608-19972630 TGTGTGCATGGCTTTTGAGTCGG + Intergenic
1095929086 12:47607813-47607835 TGTCCCCATGGCTTTGGGTTGGG + Intergenic
1098293078 12:68977393-68977415 TGTCTGGGTGTCTTTTCCTTGGG - Intergenic
1099407046 12:82277069-82277091 TGTGTGCATGTATTTTAATTAGG + Intronic
1100550271 12:95640455-95640477 TGTCTGCAGGTCTGTGGGTCAGG - Intergenic
1101372678 12:104143865-104143887 TGTTTTCATGTCTTTTGAGTTGG - Intergenic
1101614245 12:106320481-106320503 TGTCTGCATAGCTTTTCTTTGGG + Intronic
1102074211 12:110047213-110047235 TGTGTGCATGGCTTTGGCTTTGG - Intronic
1102640648 12:114363481-114363503 TTCCTGCCTGTCTTTTGGTCTGG + Intronic
1104121379 12:125803320-125803342 TTTCTGCCTGTTTTTTGGTCGGG + Intergenic
1104819720 12:131668501-131668523 TCACTCCATGTCTTTTGATTGGG - Intergenic
1106528157 13:30561860-30561882 TGTCTGCATTTCCTGTGGATGGG - Intronic
1106774590 13:32996578-32996600 TGTCTGCATGCCTTTTCTTTGGG - Intergenic
1109000673 13:56799656-56799678 TTTCTGTATGTATTTTGCTTGGG - Intergenic
1109015306 13:57003205-57003227 TGTCTGGATATGTTTTTGTTTGG + Intergenic
1109066743 13:57704293-57704315 TGTCTTCATGACTTTTTGGTAGG + Intronic
1110943129 13:81377791-81377813 TGTCTCCATCTCTTTTTGATAGG - Intergenic
1111554419 13:89861836-89861858 TTTCTGCATGTCCTATGATTTGG - Intergenic
1111981483 13:95020678-95020700 TGACTGTAAGCCTTTTGGTTTGG - Exonic
1112555236 13:100461757-100461779 TGTCTGCTTGTGCTGTGGTTTGG + Intronic
1112972386 13:105276324-105276346 TGTCTGCCTGTTTTTAAGTTGGG - Intergenic
1113293519 13:108932353-108932375 TTTCTCCATGTTTTGTGGTTTGG + Intronic
1113305871 13:109078132-109078154 ATTCTGCATGTCTTTAGGCTAGG + Intronic
1115499469 14:34036439-34036461 TATCTGCATGACTTTGGGTAAGG - Intronic
1116807471 14:49507977-49507999 GGGCTGCCTGTCTTTTGGATAGG - Intergenic
1116961308 14:50971002-50971024 TGTCTGCAGGCTTATTGGTTGGG - Intergenic
1117209406 14:53480472-53480494 TGTCTGCTTGCCCTTTGGTGAGG + Intergenic
1117399619 14:55346870-55346892 TGTCTGCTTGGCATTTTGTTGGG + Intronic
1123424900 15:20163305-20163327 TGTGTGTGTGTGTTTTGGTTTGG + Intergenic
1123534124 15:21169838-21169860 TGTGTGTGTGTGTTTTGGTTTGG + Intergenic
1123821566 15:24035870-24035892 CATCTGAATCTCTTTTGGTTGGG - Intergenic
1125801389 15:42451218-42451240 TGTCTGCTTGTTTAGTGGTTTGG + Exonic
1126286849 15:47022747-47022769 TATCTGCATGGCTTCTGGTAGGG - Intergenic
1126446983 15:48758291-48758313 TTTCTGGACCTCTTTTGGTTTGG + Intronic
1127799707 15:62467199-62467221 TGCCTCCAAGTCTTTTGGTCAGG + Intronic
1129639351 15:77358455-77358477 TTACAGCATGACTTTTGGTTTGG - Intronic
1130845042 15:87736133-87736155 TGTCTGTTTGTCTTCTGGGTTGG + Intergenic
1131325871 15:91444463-91444485 TTACTGCATTTCTTATGGTTTGG - Intergenic
1132267163 15:100484311-100484333 TGTCTGAATCTATTCTGGTTCGG + Intronic
1133521942 16:6567121-6567143 TCTCTGCATCGCCTTTGGTTTGG + Intronic
1136108351 16:28047563-28047585 CTTCTCCATGTCTTTTTGTTAGG - Intronic
1136859957 16:33692439-33692461 TGTGTGTGTGTGTTTTGGTTTGG - Intergenic
1137552599 16:49450462-49450484 TTTCTGCATGTTTTTGTGTTTGG + Intergenic
1137579453 16:49624566-49624588 TGTCTTCTTTTGTTTTGGTTTGG - Intronic
1137696538 16:50465652-50465674 TGTCTGCAGGCCTTATGCTTGGG + Intergenic
1138375250 16:56558858-56558880 TGTGTGCATATATTTGGGTTGGG + Intergenic
1140968708 16:79992439-79992461 AGTCTGCATTTCTTTGGGTGGGG - Intergenic
1203121464 16_KI270728v1_random:1540618-1540640 TGTGTGTGTGTGTTTTGGTTTGG - Intergenic
1143374620 17:6459911-6459933 GGTCTTCCTGTCTTTTGCTTGGG + Intronic
1143809680 17:9461226-9461248 TATCTGCTTGTGTTTTGGATTGG - Intronic
1144230495 17:13198591-13198613 TGACTGCATGTTTTTTGGTGGGG - Intergenic
1146576644 17:33999317-33999339 TCACTGTATGTCTTTTGATTGGG + Intronic
1146587879 17:34098252-34098274 TGTCAAGATGTCTCTTGGTTAGG - Intronic
1146599513 17:34202519-34202541 TGCCTGCAGCTCTTTTGGTGTGG + Intergenic
1146616818 17:34363153-34363175 GATCTGCATGTCTTCTGGTCTGG + Exonic
1147585500 17:41651902-41651924 TGTGTGCATGTGTGTTGGTGGGG - Intergenic
1147585519 17:41652096-41652118 TGTGTGCATGTGTGTTGGTAGGG - Intergenic
1149024089 17:52004344-52004366 TCTCTCTGTGTCTTTTGGTTTGG - Intronic
1149401662 17:56302744-56302766 TATATGTATGTCTCTTGGTTTGG - Intronic
1151051212 17:70980288-70980310 TGTCAGCCTGTCTTTTGTTATGG + Intergenic
1151106864 17:71625399-71625421 TGTTTGTTTGTTTTTTGGTTCGG + Intergenic
1153604828 18:6822058-6822080 TGTCTGCATGTTTTTGAGTCAGG + Intronic
1153716336 18:7852905-7852927 TGTCAGCTTTTCTTTTGTTTAGG - Intronic
1155606700 18:27614233-27614255 TATCTTCAGGTCATTTGGTTAGG + Intergenic
1157020405 18:43774492-43774514 TGTCTGCATGCCTATTTCTTTGG - Intergenic
1158900223 18:61955539-61955561 TATATGGATGTCTTTTTGTTTGG + Intergenic
1159097779 18:63924144-63924166 TTTCTGTGTGTCTTTTTGTTTGG + Intronic
1159339332 18:67114876-67114898 TGTCTGTTTGTTTTTTGGCTGGG + Intergenic
1161539443 19:4841159-4841181 TGTGTGCATGTCTTTGTGTGTGG - Intronic
1162238799 19:9330792-9330814 GGTCTCCATTTCTTTTGGGTTGG + Intronic
1162610151 19:11743259-11743281 TGTCTGCATGTTTAATGGATGGG + Intergenic
1163327979 19:16617533-16617555 TGTCCGCCTGTCTTGTGGATGGG - Intronic
1163516902 19:17770309-17770331 TGTGTGTGTGTGTTTTGGTTTGG - Intronic
1163559516 19:18010451-18010473 AGGCTGTATGTCCTTTGGTTGGG - Intronic
1163736462 19:18984320-18984342 TGTCTCTGTGTCTTTTGGCTAGG + Intergenic
1163841638 19:19614675-19614697 TGTTTGGCTGTTTTTTGGTTTGG - Intronic
1164449864 19:28351248-28351270 TGTCTTCATTTCTTTAGGTTTGG - Intergenic
1164499287 19:28801236-28801258 GTTCTGCATCTCTTTTGGATCGG - Intergenic
1165205563 19:34182474-34182496 TGTTTGTTTGTTTTTTGGTTTGG + Intronic
1165604838 19:37093081-37093103 TGTCTGCTTGGCTTCTGGTGAGG + Exonic
1165744583 19:38222975-38222997 TGTCTGCATGTGTTCAGGTAGGG - Intronic
1165893654 19:39129225-39129247 AGTCTGGATGTCTCTTGGTGGGG + Intronic
1166295992 19:41889753-41889775 TTTCTGCATATCTGATGGTTTGG - Intronic
1166749004 19:45155906-45155928 TGTCAGGATGTCTGGTGGTTGGG + Exonic
1167394712 19:49220678-49220700 TGTCTTCAGTTCTTTTGGGTAGG + Intergenic
1167734451 19:51283639-51283661 TGTTTGTTTGTTTTTTGGTTTGG + Intergenic
1167811717 19:51839148-51839170 TGTCTGCATGACTTTGGGCAAGG - Intergenic
1168063387 19:53906568-53906590 TGTCTGCACCTCCTTTTGTTGGG - Intronic
1168596007 19:57678006-57678028 TGTTTGCTTCTCTTGTGGTTTGG - Exonic
925020072 2:562284-562306 TGTTTGCATTTATTGTGGTTTGG + Intergenic
925074587 2:1004842-1004864 TCTCTGCATGTTTTTTGTGTGGG - Intronic
926124609 2:10264528-10264550 TGTCTGGAGGTCTCTTGGGTTGG + Intergenic
926728087 2:16014142-16014164 TGTCTTCATCTCATTTGGTTTGG + Intergenic
926846833 2:17150380-17150402 TGTCTGCAGGTCTCTGGTTTTGG - Intergenic
927305033 2:21561392-21561414 TGTCTGCTTGTCTTTTTGTGAGG + Intergenic
931185001 2:59941267-59941289 TGTCTGCAGGCCTCTTGCTTGGG + Intergenic
931327312 2:61240179-61240201 TAACTGAATGTGTTTTGGTTTGG - Intronic
932309787 2:70730406-70730428 TGTGTCCATGTCTTCTTGTTAGG - Intronic
932653751 2:73588560-73588582 TGTCTGGTTGTCTTCTGGTGGGG + Intronic
932986935 2:76737569-76737591 TGTTTGTTTGTTTTTTGGTTTGG + Intergenic
933054042 2:77639127-77639149 CGTCTGCATGTATTTTGCTGAGG + Intergenic
933430195 2:82167126-82167148 TGTGTGTCTGTCTTTGGGTTGGG + Intergenic
934458318 2:94193548-94193570 TGTGTGTGTGTGTTTTGGTTTGG - Intergenic
934958914 2:98649929-98649951 TGTCTTCATTTCTTTGGGGTTGG - Intronic
936125560 2:109786763-109786785 TAACTGCATGTTTTTTTGTTTGG - Intergenic
936219133 2:110584705-110584727 TAACTGCATGTTTTTTTGTTTGG + Intergenic
936229800 2:110690382-110690404 TTTCTGCTTCTCTTTTGGATAGG + Intergenic
936766240 2:115851829-115851851 TATCTGCATGGCTTCTGGTGAGG - Intergenic
937057127 2:118948230-118948252 TGTCTGCTTTTCTTTTGTTCAGG - Intronic
937314286 2:120921249-120921271 TGTGTGCATGTGTGTTGGTGGGG + Intronic
938045424 2:128114704-128114726 TTTCTCCATTTCTTATGGTTGGG + Intronic
940143199 2:150518099-150518121 TGTTTGCATATCTTGTGGCTTGG - Intronic
941389850 2:164898070-164898092 TGTGTAGATGTCTTTTGGTGGGG - Intronic
941928700 2:170920224-170920246 AATCTGCATGGCCTTTGGTTTGG + Intergenic
942394946 2:175537177-175537199 GGTCCTCATTTCTTTTGGTTTGG + Intergenic
943228009 2:185206004-185206026 TCTCTGCTTGTCTTTGAGTTGGG + Intergenic
944071652 2:195676471-195676493 TGTCTTTATGTCTTTGGGATAGG - Intronic
944861867 2:203822763-203822785 TGTCGGTTTTTCTTTTGGTTTGG - Intergenic
946066620 2:216993249-216993271 AGTCTGCTTGGGTTTTGGTTGGG + Intergenic
946777826 2:223162031-223162053 TGTCTGCGTGGCTTTTCTTTGGG - Intronic
948557979 2:238829192-238829214 TGTTTGTTTGTATTTTGGTTTGG - Intergenic
948746853 2:240102953-240102975 TGTTTCCATTTGTTTTGGTTTGG - Intergenic
1168982426 20:2018286-2018308 AATCTTCATGTCCTTTGGTTAGG + Intergenic
1169155718 20:3328004-3328026 TCTTTGCATGTCTTTGGGTTTGG - Intronic
1170013716 20:11756939-11756961 TGGCTCTATGTCTTTTGGTAGGG + Intergenic
1171188817 20:23143653-23143675 TGCCTACCTGTCCTTTGGTTTGG - Intergenic
1171277635 20:23871649-23871671 TGGCTGAATGTCTATTGGTGTGG - Intergenic
1172255387 20:33513053-33513075 CGTATGTATGTCTTTTTGTTGGG + Intronic
1172789005 20:37489554-37489576 TGTCTGCATTCCTTTTCGTATGG - Intergenic
1174199795 20:48799346-48799368 TGTCTGCATGTCCTTGTGGTGGG - Intronic
1174240022 20:49126117-49126139 AGTCTTCATGACTTTGGGTTTGG + Intronic
1174570991 20:51501054-51501076 TGTTTGAGTGTCTTTAGGTTGGG - Intronic
1177603992 21:23355381-23355403 TGTCAACAGGTCTTTTTGTTGGG + Intergenic
1178454996 21:32740910-32740932 TGTCTTCAAATCTTTTGCTTAGG - Intronic
1179559456 21:42204633-42204655 TGTCTGCTAGTATTTTGTTTGGG + Intronic
1180152213 21:45955329-45955351 TGTCTGCCTTTCCTTTGCTTAGG - Intergenic
1180856049 22:19046069-19046091 TGTCTGCTAGAATTTTGGTTGGG + Intronic
1181357892 22:22312879-22312901 TGTGTGTGTGTGTTTTGGTTTGG + Intergenic
1181497418 22:23295351-23295373 TGTCTGCGTGTCTGTTGCGTCGG + Intronic
1181577851 22:23807115-23807137 TGTCCACATGTGTTCTGGTTAGG - Intronic
1184604999 22:45567689-45567711 TGTCTGGGTGTTTTTTGGTTGGG - Intronic
1185005815 22:48276340-48276362 TGTCTGCATGTATTTGTGTGTGG - Intergenic
949369184 3:3316566-3316588 TGTCTTCATGTCTTTGGGGTTGG + Intergenic
949454623 3:4225559-4225581 TGTCTGCATGTGTGTTAGCTGGG - Intronic
950117128 3:10458357-10458379 TTTCTGCACAACTTTTGGTTCGG + Intronic
953423657 3:42774309-42774331 TGTATGCATGTCTATGGGATGGG - Intronic
953631420 3:44621335-44621357 TTTCTGCCTGTCTTCTGGCTGGG + Intronic
954189151 3:48943996-48944018 CATCTGCATTTCTTTTGGTTGGG + Intronic
954971984 3:54659022-54659044 TTCCTTCATGTCTTTTGCTTAGG + Intronic
955220201 3:57017072-57017094 TGTGTGCATTTCCTTTTGTTTGG - Intronic
956393035 3:68794866-68794888 TTTCTGTTTGTCTTTTTGTTGGG - Intronic
957568639 3:81917467-81917489 TGTGTGCATTTCTTTAGTTTGGG + Intergenic
958446399 3:94220640-94220662 TGATTGCATGTCTTTTGCTAAGG + Intergenic
960736110 3:120782393-120782415 TTGCTTAATGTCTTTTGGTTTGG + Exonic
960737623 3:120798009-120798031 TGTTTGCATGTCTTTGTGTTAGG - Intergenic
960898178 3:122528173-122528195 TGTCTTTATGTCTTGGGGTTGGG - Exonic
961613632 3:128161403-128161425 TGTCTCCCAGTCTTTTGTTTCGG + Intronic
961726127 3:128932182-128932204 TGTTTTCATGTCTTTTTGGTTGG + Intronic
962503467 3:136019844-136019866 TTTCTTCATGTCTTTTGATGAGG - Intronic
962546917 3:136446378-136446400 TGACTGCATGTCCTTTGATTTGG + Intronic
962653704 3:137521011-137521033 TGTCTGCACGACTTTAGGTAAGG + Intergenic
963719147 3:148840084-148840106 TATTTGCTTGTCTTTTGGGTGGG - Intronic
963731965 3:148983454-148983476 AATCTTCATGACTTTTGGTTAGG + Intergenic
964240774 3:154591446-154591468 TGTCTGAATAACTTTTTGTTGGG - Intergenic
964619136 3:158703414-158703436 TTTTTGCATTTTTTTTGGTTGGG - Intronic
966680300 3:182634921-182634943 TGTGTTCATGTCTTTTGATGAGG - Intergenic
966752637 3:183337219-183337241 TGTTTTCATTTCTTCTGGTTGGG + Intronic
968196250 3:196709649-196709671 TGTCTGCAGGGCTTTTATTTTGG + Intronic
970037565 4:11755206-11755228 TGTTTGCTTGTTTTTTAGTTTGG - Intergenic
970263373 4:14253570-14253592 TGTTTGCTTGTTTTTTTGTTAGG + Intergenic
970427699 4:15960841-15960863 TGTCCTCATCTCTTTTTGTTAGG - Intronic
971299617 4:25430937-25430959 TGTCTCCAGAGCTTTTGGTTGGG - Intergenic
971594141 4:28507080-28507102 TGTCTAGATGACCTTTGGTTGGG + Intergenic
973658238 4:53073612-53073634 TGTCTGCAGATCTTTTGGCAGGG - Intronic
974813573 4:66977043-66977065 TTTCTATATTTCTTTTGGTTTGG - Intergenic
974822276 4:67082424-67082446 TGTTTTCTTGTGTTTTGGTTTGG + Intergenic
976357866 4:84141269-84141291 AATCTGCATGCCCTTTGGTTTGG + Intergenic
977402202 4:96546956-96546978 TTTCTCCATGTTTTTAGGTTGGG + Intergenic
978274450 4:106932737-106932759 TTTCTTCCTCTCTTTTGGTTAGG - Intronic
979606662 4:122645681-122645703 TGTCTGTATGGCTCTGGGTTAGG + Intergenic
980535437 4:134114658-134114680 TGTCTCCAAGTCTATTCGTTGGG + Intergenic
980564991 4:134527991-134528013 AGTCTGTATGTTTTCTGGTTAGG - Intergenic
980595009 4:134943042-134943064 TTTCTCCTTGTTTTTTGGTTTGG - Intergenic
981135255 4:141203810-141203832 TGTCTTCTTGGCTTTTGGTAAGG + Intronic
981483204 4:145258914-145258936 TGTGTGCATGTGTTTTTGCTGGG - Intergenic
982620678 4:157700585-157700607 ACTCTGGATGTCTCTTGGTTTGG + Intergenic
983403795 4:167299535-167299557 TTTCTGTATGTCTTTCAGTTTGG - Intergenic
983991242 4:174122519-174122541 TGTATGCATGTCTTTGGGGGAGG - Intergenic
985748849 5:1663187-1663209 TGTCTGCATGTCTGTGTGTCTGG + Intergenic
985845481 5:2342918-2342940 TGTTTGTATGTCTGTTGGGTTGG + Intergenic
985886047 5:2679707-2679729 TGTCTGAATTTATTTTGGCTAGG - Intergenic
986693220 5:10331006-10331028 AGTTTGCAAGTCTTTTGGTTTGG - Intergenic
987203460 5:15600877-15600899 TGTCTGTCTGTCTTTTGCTGGGG + Intronic
987603438 5:20102717-20102739 TGTCTCTATTTCTTTTGTTTTGG - Intronic
987771931 5:22316325-22316347 TGTGTGCATGTGTGTTGGTGGGG - Intronic
988127123 5:27054802-27054824 TCACTGCAAGTCCTTTGGTTTGG + Intronic
988646967 5:33105383-33105405 AGTCTGCATGTGTTATTGTTGGG - Intergenic
988958644 5:36346870-36346892 TGTCTTCAGGTCTTTGAGTTTGG - Intergenic
989124837 5:38042188-38042210 TGTCTACACATCTTTTTGTTGGG + Intergenic
989195583 5:38713358-38713380 TGTCTCCAAGGCTTTTGGTTGGG - Intergenic
989398165 5:40980812-40980834 TGTCTGGGTCACTTTTGGTTAGG + Intronic
989992158 5:50779746-50779768 TGTCTGCATGTTTTTCCTTTAGG + Intronic
990320607 5:54626553-54626575 TGTCTGGATGAACTTTGGTTTGG + Intergenic
991149384 5:63348540-63348562 TGTTTGCCTCTCTTTTTGTTTGG + Intergenic
991478518 5:67050302-67050324 TGTCTGCATGGTTTTTGCTCAGG - Intronic
991513692 5:67410285-67410307 TGTGTGCATGTGTATTGGTCAGG + Intergenic
992956308 5:81912360-81912382 TGTCTTTTTGTCTTTTTGTTAGG - Intergenic
992993149 5:82305932-82305954 TCTCTGCATTTGTTCTGGTTTGG + Intronic
994671857 5:102771575-102771597 TGTCTTCATGTCTGGTGGCTTGG + Intronic
995537129 5:113147819-113147841 AGTCGGCATGTATTTTTGTTAGG - Intronic
996577694 5:124994238-124994260 TGTCTGCATTTCTTTTTTTGTGG + Intergenic
996991064 5:129632556-129632578 CTTCTCCATGTCTTTTAGTTGGG + Intronic
997181577 5:131834117-131834139 TGACTGCAAATATTTTGGTTTGG + Intronic
997580103 5:135011802-135011824 GGTCTGCATGTCCTGTGGTGGGG - Intergenic
998696007 5:144640387-144640409 TGTCTGCAGTTCTGTTCGTTAGG + Intergenic
999297320 5:150467973-150467995 TGTCTTCGTGTCTTATGGTTTGG - Intergenic
999844567 5:155464791-155464813 TTTCTTCATGTCTTATGCTTGGG + Intergenic
1000268931 5:159664578-159664600 TCTGTCCATGTCCTTTGGTTTGG + Intergenic
1000799557 5:165707781-165707803 TGTCTGGGTGTATTTTGGGTGGG - Intergenic
1000801732 5:165736485-165736507 TGTATGCATTTCTTTTTCTTTGG + Intergenic
1002984708 6:2177812-2177834 AGTATGCATGTCTTTTTGGTAGG - Intronic
1003823577 6:9927555-9927577 TGTATGTCTCTCTTTTGGTTAGG - Intronic
1004070699 6:12294664-12294686 TCTCTGGATATATTTTGGTTGGG - Intronic
1006318308 6:33304153-33304175 TGTCTGCCTTTCTTCTGCTTGGG - Exonic
1006504407 6:34478901-34478923 GGTCTGCTTGTCTTCTGGTGAGG + Intronic
1007255312 6:40524207-40524229 AATCTGCATGTGTTTTGTTTTGG - Intronic
1007389942 6:41545390-41545412 TGTCTGCATGTGTTGGGGGTGGG - Intergenic
1007739930 6:44004071-44004093 GGTCTGCATGTTTCTTGGTAAGG + Exonic
1007835450 6:44670365-44670387 AGTCTGCATTGTTTTTGGTTGGG + Intergenic
1009572554 6:65406503-65406525 TGTCTTCATGACCTTGGGTTAGG - Intronic
1010285011 6:74066722-74066744 TGACTTCATGTCTTGTGGTTTGG + Intergenic
1010898703 6:81399407-81399429 TGTCTCCAGGGCTTCTGGTTTGG - Intergenic
1011194835 6:84770311-84770333 TTTCAGCATGACTTTTGGTTTGG + Intergenic
1011195655 6:84776510-84776532 TTTCTTCTTGTCTTTTGATTGGG - Intergenic
1011243717 6:85299752-85299774 TCTCTGAATGTATTCTGGTTTGG - Intergenic
1011273879 6:85608537-85608559 TGTCTGCAGGCCCTTTGATTTGG - Intronic
1011891136 6:92161383-92161405 TTTCAGCATATCTTTTGTTTTGG + Intergenic
1011909435 6:92417355-92417377 TGTTTGTATTTCTCTTGGTTTGG - Intergenic
1012027551 6:94016702-94016724 AGTCTGCCTGTCTTTGGATTTGG + Intergenic
1012681261 6:102184133-102184155 TTCCAGTATGTCTTTTGGTTAGG - Intergenic
1013458454 6:110353949-110353971 TATCTGCATGTGTTTCTGTTTGG - Intronic
1014398605 6:120958308-120958330 TGTCTTCATTTGTTTTTGTTTGG + Intergenic
1014746182 6:125203586-125203608 TGTCTGCATGGTTTTGAGTTTGG + Intronic
1014960218 6:127674109-127674131 TGTGTGCTTGTTTTTTGATTTGG + Intergenic
1015131931 6:129820919-129820941 TCTGTGCATGTCTTTTCCTTAGG + Intergenic
1016672308 6:146723176-146723198 TGGCTTCAGGGCTTTTGGTTTGG - Intronic
1016950438 6:149574365-149574387 TGTCAGTCTGTCTTTTAGTTGGG + Intronic
1017555114 6:155555747-155555769 TGGCTGTGTGTCTCTTGGTTTGG + Intergenic
1018927786 6:168218511-168218533 TTTCTGTATATCTTTTGCTTTGG - Intergenic
1019350022 7:550227-550249 TGTCCGCTTGTCCTTTGATTTGG + Exonic
1021387859 7:20053834-20053856 TGTCTGCATCCCTTTTGGTAGGG + Intergenic
1023890060 7:44385627-44385649 TGCTTGCATGTCTTCTGGTTGGG - Exonic
1024062151 7:45706911-45706933 CATCTGCATCTCTTTTGGTGAGG - Intronic
1027353257 7:77333163-77333185 TCTCTGCATTTCTTTTTTTTTGG - Intronic
1027596727 7:80183732-80183754 TGTCTGCCTCTGATTTGGTTGGG - Intronic
1030186569 7:106768263-106768285 TGTCTGAATCTATTCTGGTTTGG + Intergenic
1030607342 7:111651740-111651762 TGTCTGTCTGTTGTTTGGTTGGG - Intergenic
1030844421 7:114391456-114391478 TGATTGCATGTTTTTTGGTGTGG + Intronic
1030976925 7:116137969-116137991 TGACCGCATTTCTTCTGGTTTGG - Intronic
1031793011 7:126134173-126134195 TGTTTGCTTGTATGTTGGTTTGG + Intergenic
1033207381 7:139434566-139434588 AGGCTGCAAGTCTTTTGATTTGG - Intergenic
1035135110 7:156695730-156695752 TGTGTGCATGTGATATGGTTTGG - Intronic
1035137286 7:156716632-156716654 TGTCCTTATTTCTTTTGGTTTGG + Intronic
1037129148 8:15386531-15386553 TGTCTGCATGTAATGTAGTTTGG + Intergenic
1038536649 8:28358410-28358432 TGTTTGTTTGTTTTTTGGTTTGG + Intronic
1039927097 8:41945207-41945229 TGTGTGCATTTTTTTTAGTTAGG - Intronic
1040923801 8:52654070-52654092 TGTCTCCATGTCTTCTGGACAGG - Intronic
1040945287 8:52877616-52877638 GGTCTGTATGTGATTTGGTTTGG + Intergenic
1042900632 8:73723226-73723248 TGTCTGCATGGGTTTTCTTTGGG - Intronic
1043216548 8:77597871-77597893 TTACTGTATGTCTTTTGATTGGG - Intergenic
1043369659 8:79575824-79575846 TGTTTGGATAACTTTTGGTTGGG - Intergenic
1043636207 8:82386282-82386304 TTTCTATATGTTTTTTGGTTGGG + Intergenic
1043991365 8:86759670-86759692 TGTTTGTATGTCTTTAAGTTAGG + Intergenic
1045593851 8:103630086-103630108 AGCCTGAATTTCTTTTGGTTTGG - Intronic
1046369109 8:113276997-113277019 GGTTGGCATGTTTTTTGGTTTGG - Intronic
1047135267 8:122070735-122070757 AGTCTGCATGTGTTTTACTTTGG + Intergenic
1047323814 8:123817164-123817186 TGTCTTCGTGTCCTGTGGTTTGG + Intergenic
1047463429 8:125090619-125090641 TGAAAGCATGTCTTTTGATTAGG - Intronic
1048622928 8:136154290-136154312 TGTTTGTTTGTTTTTTGGTTTGG - Intergenic
1050714433 9:8505862-8505884 TGTATGCCTGTATTTTAGTTTGG + Intronic
1051706931 9:19890522-19890544 TGTCAGCATATTTATTGGTTGGG + Intergenic
1051805466 9:20987896-20987918 TCTTTACATGTCTTTGGGTTAGG + Intronic
1052707098 9:32007364-32007386 TTTCTGCATATCTTTTTTTTGGG + Intergenic
1052781797 9:32789302-32789324 TGTACACATTTCTTTTGGTTGGG - Intergenic
1053688826 9:40569353-40569375 TGTGTGTGTGTGTTTTGGTTTGG - Intergenic
1053763745 9:41367424-41367446 TGTCAGCATCTCTTTAGTTTTGG + Intergenic
1054275210 9:63061711-63061733 TGTGTGTGTGTGTTTTGGTTTGG + Intergenic
1054300067 9:63370264-63370286 TGTGTGTGTGTGTTTTGGTTTGG - Intergenic
1054399620 9:64703227-64703249 TGTGTGTGTGTGTTTTGGTTTGG - Intergenic
1054433203 9:65187492-65187514 TGTGTGTGTGTGTTTTGGTTTGG - Intergenic
1054497180 9:65834183-65834205 TGTGTGTGTGTGTTTTGGTTTGG + Intergenic
1055045328 9:71918237-71918259 TGTTTGCTTGCCTTTTGTTTTGG + Intronic
1055194984 9:73579507-73579529 TGTCTGTCAGTCCTTTGGTTTGG + Intergenic
1055803444 9:80066641-80066663 TGTCTGGATGTGTTTTGGGATGG - Intergenic
1055943182 9:81669619-81669641 TGTGTGCATGTCTTTTGGTGTGG - Intronic
1056792837 9:89637388-89637410 TGTCTGGATGTCTTTTCATTTGG + Intergenic
1057051220 9:91925612-91925634 TGTGTGCATGTATTTGGGGTTGG - Intronic
1058946644 9:109863453-109863475 TGACTGCATGTGTTTGAGTTTGG + Intronic
1059149045 9:111930926-111930948 TGTTTACATGTCTTGTTGTTTGG + Intronic
1059563630 9:115360193-115360215 TCTCTGCATTTCTTTGGGCTGGG - Intronic
1059563643 9:115360286-115360308 TCTCTGCATTTCTTTGGGCTGGG - Intronic
1059927405 9:119224387-119224409 TTTCTGAATGTATTTGGGTTTGG - Intronic
1061307982 9:129743341-129743363 TGCCTCCATGTCTCTCGGTTTGG - Intronic
1203707432 Un_KI270742v1:65795-65817 TGTCTGCCTGTCTGTTTTTTAGG + Intergenic
1186268299 X:7856745-7856767 TTTTTGTATGTCTTTTGATTTGG + Intergenic
1187021976 X:15393153-15393175 TGGCACCATGTCTTTTGCTTTGG + Intronic
1187466347 X:19531124-19531146 TTTCTTCATGTTTTTTCGTTTGG + Intergenic
1187834805 X:23421153-23421175 TGTCTGCTTGACTTCTGGTGAGG - Intergenic
1192817555 X:74610421-74610443 TGTTTGTTTGTTTTTTGGTTAGG - Intronic
1193630174 X:83875767-83875789 TGTCTCTATGATTTTTGGTTGGG + Intronic
1194012759 X:88582964-88582986 TGTCTGCACGTGGTTTGGTAGGG + Intergenic
1195573249 X:106420501-106420523 TGTCTGCATTGCTATTGCTTGGG - Intergenic
1196542515 X:116925721-116925743 TGACTTCATTTGTTTTGGTTTGG + Intergenic
1197412809 X:126139496-126139518 TGTCTGCATGTGTCATTGTTGGG - Intergenic
1197439906 X:126475587-126475609 TGTCTGTAGCTCTTTTGTTTTGG - Intergenic
1197511679 X:127376956-127376978 TGTCTGCAAGTATTTTGTTGAGG - Intergenic
1197653117 X:129086870-129086892 GGTCTGCATGGCTATTGGTCAGG - Intergenic
1198611574 X:138407213-138407235 TGTCTGCTTGGCTTATGGTGAGG + Intergenic
1199512974 X:148643405-148643427 TGTTTGCAGCTCTCTTGGTTTGG + Intronic