ID: 1065841472

View in Genome Browser
Species Human (GRCh38)
Location 10:29704824-29704846
Sequence AGAGGTGTCTGCATGTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 216}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065841472_1065841480 2 Left 1065841472 10:29704824-29704846 CCAAAAGACATGCAGACACCTCT 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1065841480 10:29704849-29704871 GGAGTCCTGGGGATTTTCAGGGG No data
1065841472_1065841479 1 Left 1065841472 10:29704824-29704846 CCAAAAGACATGCAGACACCTCT 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1065841479 10:29704848-29704870 AGGAGTCCTGGGGATTTTCAGGG No data
1065841472_1065841478 0 Left 1065841472 10:29704824-29704846 CCAAAAGACATGCAGACACCTCT 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1065841478 10:29704847-29704869 CAGGAGTCCTGGGGATTTTCAGG No data
1065841472_1065841486 13 Left 1065841472 10:29704824-29704846 CCAAAAGACATGCAGACACCTCT 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG No data
1065841472_1065841487 14 Left 1065841472 10:29704824-29704846 CCAAAAGACATGCAGACACCTCT 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1065841487 10:29704861-29704883 ATTTTCAGGGGGTTGGGGAAGGG No data
1065841472_1065841488 20 Left 1065841472 10:29704824-29704846 CCAAAAGACATGCAGACACCTCT 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1065841488 10:29704867-29704889 AGGGGGTTGGGGAAGGGAACAGG No data
1065841472_1065841476 -9 Left 1065841472 10:29704824-29704846 CCAAAAGACATGCAGACACCTCT 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1065841476 10:29704838-29704860 GACACCTCTCAGGAGTCCTGGGG No data
1065841472_1065841489 21 Left 1065841472 10:29704824-29704846 CCAAAAGACATGCAGACACCTCT 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1065841489 10:29704868-29704890 GGGGGTTGGGGAAGGGAACAGGG No data
1065841472_1065841483 7 Left 1065841472 10:29704824-29704846 CCAAAAGACATGCAGACACCTCT 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1065841483 10:29704854-29704876 CCTGGGGATTTTCAGGGGGTTGG No data
1065841472_1065841481 3 Left 1065841472 10:29704824-29704846 CCAAAAGACATGCAGACACCTCT 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1065841481 10:29704850-29704872 GAGTCCTGGGGATTTTCAGGGGG No data
1065841472_1065841475 -10 Left 1065841472 10:29704824-29704846 CCAAAAGACATGCAGACACCTCT 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1065841475 10:29704837-29704859 AGACACCTCTCAGGAGTCCTGGG No data
1065841472_1065841484 8 Left 1065841472 10:29704824-29704846 CCAAAAGACATGCAGACACCTCT 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1065841484 10:29704855-29704877 CTGGGGATTTTCAGGGGGTTGGG No data
1065841472_1065841485 9 Left 1065841472 10:29704824-29704846 CCAAAAGACATGCAGACACCTCT 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1065841485 10:29704856-29704878 TGGGGATTTTCAGGGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065841472 Original CRISPR AGAGGTGTCTGCATGTCTTT TGG (reversed) Intronic
903376647 1:22870581-22870603 AGGGCTGTCTGCTTGTCATTCGG - Intronic
903406511 1:23101767-23101789 AGAGGTGTCTACTTTGCTTTTGG - Intronic
903586145 1:24416641-24416663 AGAGGTGACTGCTTGCCTCTCGG + Intronic
904296096 1:29520778-29520800 AGAGGTGTCTGCCTCCCTCTAGG + Intergenic
905044760 1:34987146-34987168 AGATGTGACTGCAAGTCTTAGGG + Exonic
905573484 1:39025026-39025048 AGTGTTGTGTGTATGTCTTTGGG - Intergenic
907335818 1:53698719-53698741 AGAGGTGGCTGCAGGTCTGGAGG - Intronic
907458375 1:54590490-54590512 ATGGGTGTCTGCTTGGCTTTGGG + Intronic
907748886 1:57243356-57243378 ATAGGTCTGTGCATGTCTGTGGG - Intronic
909367455 1:74844459-74844481 AGAGGAGTCTGGATACCTTTTGG + Intergenic
912702509 1:111888749-111888771 AGAGGTTTCTGTCTGTCTTTGGG - Intronic
913390738 1:118309095-118309117 ACATTTGTGTGCATGTCTTTGGG - Intergenic
913391591 1:118319986-118320008 AAAGTTGTCTTCTTGTCTTTGGG - Intergenic
914306220 1:146421309-146421331 AGGGGTGAGTGCAGGTCTTTGGG + Intergenic
917502855 1:175601364-175601386 ATATATGTTTGCATGTCTTTGGG + Intronic
918164562 1:181932161-181932183 AGAGCTATCTGCATGTGTTGTGG - Intergenic
918473054 1:184894698-184894720 AGAGGGGTCCCCATGGCTTTGGG - Intronic
919701360 1:200634610-200634632 TGAGGTGTCTGCAAGTTTTGGGG - Intronic
920858831 1:209688218-209688240 AGAGGTAACTGCATGTATTCAGG - Intronic
921152423 1:212413064-212413086 AGATGTGTCTGAAAGTTTTTAGG - Intronic
922360941 1:224820734-224820756 AAACGTGTCTGCATGTTCTTTGG - Intergenic
923494727 1:234514208-234514230 AGAGGTGTATTTATGTCTTCTGG + Intergenic
1065841472 10:29704824-29704846 AGAGGTGTCTGCATGTCTTTTGG - Intronic
1066678942 10:37917529-37917551 ATAGCTGTGGGCATGTCTTTAGG + Intergenic
1067263376 10:44714355-44714377 ATAGGTGTATGCATGTGTGTAGG + Intergenic
1068377948 10:56209474-56209496 ATAGTTGTCTGTATTTCTTTGGG + Intergenic
1069087259 10:64155498-64155520 AGAGGCCTCTGGAAGTCTTTAGG + Intergenic
1070888924 10:79927818-79927840 TGTGGTGTCTGCATTTCTTGGGG - Intergenic
1076127918 10:127990679-127990701 GGATGTGTCTGCATGTTTTGGGG + Intronic
1077081088 11:725038-725060 AGGGGTCTCTGCATGCCTTTGGG - Intronic
1079178680 11:18169067-18169089 AGAAATGTCTTCATGTCTTCTGG - Intronic
1079998246 11:27319349-27319371 AAACTTGTCTGCATGTCATTTGG + Intergenic
1080976373 11:37345686-37345708 GGAGGTGATTGCATGTGTTTTGG + Intergenic
1084451878 11:69243885-69243907 AGAGGTGACAGCATGTGTCTAGG + Intergenic
1084849171 11:71924846-71924868 AAAGTTGTCTGAGTGTCTTTAGG + Intronic
1085037751 11:73309945-73309967 AGAGGTGCCTCCAGGTCCTTTGG - Exonic
1085433616 11:76479569-76479591 AGGGGTATCTGCAGGCCTTTTGG - Intronic
1086266263 11:85002179-85002201 AAAGGAGACTGCATGTATTTGGG - Intronic
1087742501 11:101904907-101904929 AAATGTGTATGCATGTGTTTAGG - Exonic
1087833491 11:102845893-102845915 AGAAATGTCTGCATGATTTTTGG - Intergenic
1088209651 11:107440797-107440819 AGAGGTCTTTTCATGTTTTTTGG - Intronic
1088801740 11:113313232-113313254 AGGGCTGTGTGCATGTATTTGGG + Intergenic
1089027988 11:115291960-115291982 ATAGGTGTCTGCATGACATTAGG + Intronic
1095599449 12:43998927-43998949 AGATGTGTTTTCATGTGTTTGGG - Intronic
1096985447 12:55753128-55753150 AGAGGGGTCTTGTTGTCTTTGGG - Exonic
1098910301 12:76202405-76202427 AGAGGTATCTGCTTGCCTTTGGG - Intergenic
1100813496 12:98363162-98363184 AGGGGAGTCTGCATTTCTTTTGG + Intergenic
1101738844 12:107484050-107484072 AGAAGTGTCTGTAAGTCCTTTGG + Intronic
1104662479 12:130621033-130621055 AGAGGTGTGTGCATATTTTCAGG - Intronic
1105242480 13:18620472-18620494 CGAGGTCTCTGCATATATTTCGG - Intergenic
1106309118 13:28537855-28537877 CGATGTGTGTGCATCTCTTTTGG + Intergenic
1108606488 13:52044741-52044763 AGAGGTCTCTGCAACTCTTATGG - Intronic
1108920033 13:55661661-55661683 AGAGGTGTCTGAATGGCCATTGG + Intergenic
1116169623 14:41383485-41383507 AGATCTGTATGCATGTCTTTGGG - Intergenic
1118268612 14:64320152-64320174 AAAGTTTTCTCCATGTCTTTTGG - Intronic
1119339524 14:73865057-73865079 ATATGTGTGTGCATGTCTGTGGG - Intronic
1120828901 14:88980758-88980780 AGAAGTATCTTCATGGCTTTTGG - Intergenic
1123177957 14:106439852-106439874 AGAGCTGCCTGCATTTCTCTTGG + Intergenic
1128300891 15:66565736-66565758 GGAGGGGTCTGCGTGTCGTTGGG - Intronic
1128433802 15:67625492-67625514 AGAGGTGTATAGTTGTCTTTTGG + Intronic
1129261109 15:74367812-74367834 AGAGGGGTCTCCCTGTCCTTTGG - Intergenic
1133717834 16:8466466-8466488 TAAGATGTCAGCATGTCTTTTGG + Intergenic
1134215315 16:12312662-12312684 AGATGTTTCTGCTTGGCTTTGGG + Intronic
1138215096 16:55197672-55197694 TAAGGTATGTGCATGTCTTTGGG + Intergenic
1138686337 16:58729240-58729262 ACAGGTGGCTGCATGTTTTCAGG - Intronic
1140490523 16:75331800-75331822 AGAGATGTTTTCATTTCTTTTGG + Intronic
1140651389 16:77092361-77092383 AGAGGTGTCTCCAGGTCACTTGG + Intergenic
1140968711 16:79992444-79992466 AGTAGAGTCTGCATTTCTTTGGG - Intergenic
1141774650 16:86114953-86114975 TGATGTGTATGCATCTCTTTTGG + Intergenic
1141774830 16:86116331-86116353 AGCAATGTCTGCATTTCTTTTGG + Intergenic
1142069884 16:88086158-88086180 AGAGATGTCAGCACGTTTTTGGG + Intronic
1142493515 17:293561-293583 AGAGGTTTCTGCATCTTTTCCGG + Intronic
1142508156 17:378958-378980 ACAGGTGCCAGCATTTCTTTAGG + Intronic
1142559123 17:799618-799640 AGAGTTGTCTGTTTCTCTTTCGG + Exonic
1142891793 17:2948598-2948620 AGAGGTGGCTGCCTGTCTGCAGG + Intronic
1144158243 17:12529634-12529656 ACAGGTGTATGCATTTCTGTGGG + Intergenic
1146932972 17:36791202-36791224 AGATCTGTCTGCTTGTCCTTGGG - Intergenic
1149338652 17:55663950-55663972 AGAGGTGTACCAATGTCTTTTGG + Intergenic
1152998021 18:426353-426375 TGAGGTCTCTGCATGTTTTGGGG + Intronic
1153575246 18:6513206-6513228 AGGGTAGTCTGCAGGTCTTTAGG - Intronic
1154446463 18:14439405-14439427 CGAGGTCTCTGCATATATTTCGG + Intergenic
1155714005 18:28917682-28917704 ACAGCTGTCTGCATGTATTCAGG - Intergenic
1156258918 18:35426524-35426546 AGAGGTGTCTGCAGGTTCTCTGG + Intergenic
1156374969 18:36505200-36505222 GGAGGTATCTGCATTCCTTTTGG - Intronic
1159060963 18:63513376-63513398 TGATGTGTGTGCATCTCTTTTGG + Intergenic
1159652888 18:70998802-70998824 AGAGGTGTATACATTTCTTTTGG + Intergenic
1160861446 19:1238728-1238750 AGCGGTGTCAGCCTTTCTTTGGG - Intergenic
1160997523 19:1890223-1890245 AGAGGTGTATGTATGTGGTTGGG - Intergenic
1161745257 19:6055350-6055372 AGATATGTCTTCATGTCTCTTGG - Intronic
1162877577 19:13632104-13632126 CGAGGTGTGTGGATCTCTTTAGG + Intergenic
1163655816 19:18544061-18544083 GGAGGTTTCTGTATGCCTTTGGG - Intronic
1164675136 19:30095682-30095704 AGAGGAATCTGAATGTATTTGGG + Intergenic
1165366003 19:35365431-35365453 ACAGGTGTGGGCATGTCTCTGGG - Intergenic
924981422 2:225537-225559 ACTGGTGTGTGCCTGTCTTTAGG - Intronic
925214803 2:2085186-2085208 GGAGCTGTCTGCATGCCTCTTGG + Intronic
925550556 2:5069542-5069564 AAATGTCTCTTCATGTCTTTTGG - Intergenic
925603649 2:5635771-5635793 GGAGGTGAGTGCAGGTCTTTGGG + Intergenic
926268583 2:11347083-11347105 AGAGGCGTGTCCATGTCTATAGG + Intronic
927099206 2:19775073-19775095 AGAGGTGTCTGGATGTGTGAAGG - Intergenic
928118313 2:28563835-28563857 AGAGGTGTCTGCTTGTTCTTGGG - Intronic
932570310 2:72935024-72935046 AGAGGGGTCTGGATGTCGTAAGG - Intronic
932854895 2:75222779-75222801 AGAGGCATCAGCATGCCTTTAGG + Intergenic
933076048 2:77927852-77927874 ACATATGTGTGCATGTCTTTTGG + Intergenic
935857726 2:107293268-107293290 GGAGGTGTCTGCATGTACATGGG + Intergenic
936098815 2:109556527-109556549 ACAGGTTTCTGCAAGTGTTTAGG - Intronic
937033960 2:118765189-118765211 AGAAGTGTCTGCATCTGTTGAGG + Intergenic
937547709 2:123044126-123044148 AGAGCTGTCTCCATTTCATTAGG + Intergenic
939571893 2:143849734-143849756 ATACGTATCTGCATGTGTTTAGG + Intergenic
940774094 2:157868602-157868624 AGAGGTATCTGTATGTGTATAGG - Intronic
941604505 2:167580580-167580602 AGAGTGGTCTGCATTTCTTCAGG - Intergenic
943040037 2:182793475-182793497 AGAGCTCTCTGAATGTCTTCTGG - Exonic
944023651 2:195137517-195137539 AGAGATGGCTGCATGTGTGTGGG - Intergenic
945198400 2:207258243-207258265 AGCTGTGTCTGCATTCCTTTGGG + Intergenic
945318878 2:208398617-208398639 TGAGGTGTCTGGATGTGGTTTGG + Intronic
946738775 2:222781017-222781039 AGAGGTGCCTGCTTCTCCTTTGG - Intergenic
947013070 2:225587584-225587606 TGAGGTGTCTTCAGGTCTTTGGG + Intronic
947185913 2:227455366-227455388 AGAGGTGACCTCATGTGTTTAGG - Intergenic
1169545126 20:6642147-6642169 AGAGATGGCGGCATTTCTTTGGG - Intergenic
1173530859 20:43768479-43768501 GGTGGTGTCTGCGTGGCTTTGGG + Intergenic
1173728759 20:45314231-45314253 ACAGGTGTCTCCATGCCTTGGGG - Intronic
1174184368 20:48695404-48695426 ACATGTGTGTGCATTTCTTTGGG + Intronic
1174548469 20:51344157-51344179 AGAGGTGACTCCAAGTGTTTTGG + Intergenic
1175860433 20:62147601-62147623 AGTGGTGTCTGCCTGTCTGCTGG + Intronic
1177865449 21:26507657-26507679 TGAGGTGGCTGCCTGTTTTTTGG - Intronic
1179437842 21:41374409-41374431 AGAGGCTTGTGCATGGCTTTGGG + Intronic
951282114 3:20764417-20764439 AGTGGTGTCTGTATCTATTTAGG + Intergenic
951769264 3:26237387-26237409 AGAGGAGTTTGCATGCCTGTTGG + Intergenic
952762749 3:36929660-36929682 ATAGGGATCTGGATGTCTTTGGG - Intronic
954272889 3:49523400-49523422 AGAGGTGAAAGCAGGTCTTTGGG + Intronic
960086374 3:113595666-113595688 TTAGGTGTCTTCATGTGTTTAGG - Intronic
960256293 3:115514907-115514929 TGAGGTGTCCACATGTCTATGGG - Intergenic
960700593 3:120435626-120435648 TGAAGTGTGTGCATGTATTTGGG - Intronic
962246743 3:133801719-133801741 AGGGGTGTGTGCGTGTGTTTTGG + Intronic
962627275 3:137238473-137238495 TGTGGTGTCTGCCTGTTTTTTGG + Intergenic
962653703 3:137521006-137521028 AGGGCTGTCTGCACGACTTTAGG + Intergenic
963007625 3:140740795-140740817 AGAGGTCACTGCATGCCCTTGGG - Intergenic
963262467 3:143206567-143206589 AGAGGTGTGTGGCTGTCATTGGG + Intergenic
964047696 3:152350402-152350424 AGAGTTGTCTACATGTGTTGAGG - Intronic
964797052 3:160510041-160510063 AAAGGTGTCTCCATGTATTTAGG - Intronic
965545120 3:169908157-169908179 AGAAGTGCCTGCATGCCCTTGGG + Intergenic
966319459 3:178684981-178685003 AAAGATGTATGCATTTCTTTAGG - Intronic
967378436 3:188831223-188831245 AGTGGTGTCATCATGTCTTTGGG - Intronic
968192578 3:196680862-196680884 AAAAGTGTGTACATGTCTTTTGG - Intronic
970471695 4:16385696-16385718 TGAGGAGTCTGCAAGTATTTTGG + Intergenic
970759035 4:19461088-19461110 AGAAGTTTCAGCATGTCCTTTGG - Intergenic
970951078 4:21756144-21756166 AAATGTATCTGCATTTCTTTAGG - Intronic
970986842 4:22168854-22168876 ATAGGTCTCTGAATGTTTTTAGG + Intergenic
971501062 4:27318393-27318415 AGATTTGTCTGGAAGTCTTTAGG - Intergenic
973612560 4:52650108-52650130 TCAGGTGTCTTCATTTCTTTAGG - Intronic
975884128 4:78944061-78944083 AGAGATGACTGCAAGACTTTTGG - Intergenic
976116690 4:81735628-81735650 AGAGGTGCCAGCATGTCATATGG + Intronic
976635003 4:87278673-87278695 AGAGGTGGCTGCATCTCGTTAGG - Intergenic
977040947 4:92017531-92017553 TAAGGTTCCTGCATGTCTTTTGG - Intergenic
978969941 4:114791668-114791690 GGAGGTGTCTGCATGACTTGGGG - Intergenic
979153366 4:117349621-117349643 AGAGGTGTGAGCATGGCATTTGG + Intergenic
979419612 4:120487761-120487783 AGAGGTGTCAGCATGTCCAAAGG + Intergenic
980993401 4:139758227-139758249 AGAGGCGTCTGCATTTCCTGAGG + Intronic
983122966 4:163911397-163911419 AGAGGTGTGTGCCTGAGTTTAGG + Intronic
991139582 5:63224711-63224733 AGAGCTGTCTACATGGCTTCTGG + Intergenic
991321595 5:65379678-65379700 ACATGTGTGTGCATGTGTTTAGG - Intronic
991504649 5:67311715-67311737 AGTGGTGTTTGCATTTCTGTGGG - Intergenic
995986319 5:118178802-118178824 AGAAGTGTGTGCATGTGTGTGGG + Intergenic
996771684 5:127093121-127093143 AGAGGTGTCTGGATATCTAATGG + Intergenic
999145190 5:149388021-149388043 AGAGGTGGGTGCCTGTCATTAGG + Intronic
1001186710 5:169580969-169580991 AGGGGTGTGTGCAGGACTTTTGG - Intergenic
1003550502 6:7098502-7098524 AGAGGTTTCTGGATGTGATTGGG - Intergenic
1004137616 6:12982969-12982991 AGATTGGTCTTCATGTCTTTAGG - Intronic
1005354747 6:24971352-24971374 ACATGTGTCTCCATGTCTATGGG - Intronic
1006876771 6:37304329-37304351 ATATGTTTGTGCATGTCTTTTGG - Intronic
1006968026 6:38009708-38009730 AGAGGTTTCTGTATTTCTATTGG - Intronic
1007486194 6:42182352-42182374 GAAGGTGTCTGCATGTAATTAGG + Intergenic
1011512794 6:88119742-88119764 AAAGGTGACTGCCTTTCTTTAGG - Intergenic
1013161060 6:107545522-107545544 AGAGTTGTCATCATGACTTTAGG - Intronic
1014340404 6:120198406-120198428 ACTGGTGTCAGAATGTCTTTTGG - Intergenic
1014762545 6:125373006-125373028 AGAGATGTCAGCATGTGTGTGGG - Intergenic
1015884793 6:137905476-137905498 AAAGGTCTCTGCCTGTCTCTAGG + Intergenic
1019266521 7:120223-120245 AAAAGTATTTGCATGTCTTTGGG - Intergenic
1021906232 7:25336472-25336494 ATACGAGTGTGCATGTCTTTGGG - Intergenic
1022346893 7:29525671-29525693 AGAGGTGTATGCATTACTGTGGG - Intergenic
1022384560 7:29889134-29889156 AGAGGTGAATGGATGTCTTAGGG + Intronic
1023121309 7:36911731-36911753 AGAGATATCAGCATGACTTTTGG - Intronic
1025159073 7:56637126-56637148 TGGGGTTTCTGCCTGTCTTTGGG - Intergenic
1025169304 7:56741928-56741950 ACAGGTGACTGCATGTATGTCGG - Intergenic
1025727517 7:64081105-64081127 TGGGGTTTCTGCCTGTCTTTGGG + Intronic
1025815589 7:64908044-64908066 AAAAGTGTCTACATGTCTCTGGG + Intronic
1027518453 7:79171828-79171850 ATAGGTGTCAACATGTGTTTGGG - Intronic
1029852232 7:103474971-103474993 AGAGGATTCTGCATGGTTTTGGG - Intronic
1029867639 7:103652298-103652320 AGAGGTGTTTGCATGTGCTGTGG - Intronic
1034945934 7:155261817-155261839 AGAGGTGTCAGCAGGTCTAGCGG + Intergenic
1035426737 7:158783122-158783144 AGAGGTGACTTCCTGTCCTTTGG - Intronic
1037692088 8:21190453-21190475 AAAGGTGTGTGCATGTGTTGGGG + Intergenic
1038172496 8:25149392-25149414 GAAGAAGTCTGCATGTCTTTTGG - Intergenic
1039333635 8:36566364-36566386 AGATGTGTGTGTTTGTCTTTAGG + Intergenic
1040380747 8:46869171-46869193 TGGGGTTTCTGCCTGTCTTTGGG - Intergenic
1040433292 8:47365029-47365051 AAAGGAGTCTGCAAGTATTTTGG + Intronic
1042095479 8:65211305-65211327 AGATGAGTCTTCATTTCTTTGGG - Intergenic
1043360467 8:79466093-79466115 AGAGGTCCCTGCATCTCTGTGGG - Intergenic
1044431549 8:92113555-92113577 ATAGGTGTATGCATATGTTTAGG - Intergenic
1044735936 8:95277771-95277793 CGAGGTCTCTGCATGCCTCTTGG + Intergenic
1045096932 8:98807488-98807510 AGAGGTGGCTGGATCTCTTGAGG - Intronic
1047641778 8:126828435-126828457 AGAGGTGTCTGTGTGTGTTGGGG - Intergenic
1047814004 8:128442703-128442725 AGAGGTGTCAGCAGGACTTTAGG - Intergenic
1048906762 8:139096320-139096342 AGAGGTGCCAGCGTGTCTTCAGG + Intergenic
1049162646 8:141107133-141107155 AGAGATGCCTGCAACTCTTTTGG + Intergenic
1049162652 8:141107243-141107265 AGAGATGCCTGCAGCTCTTTTGG + Intergenic
1049162680 8:141107489-141107511 AGAGATGCCTGCAGCTCTTTTGG + Intergenic
1049162716 8:141107815-141107837 AGAGATGCCTGCAGCTCTTTTGG + Intergenic
1050187538 9:2990866-2990888 AGAGTTGTCTACTTGTCTCTTGG + Intergenic
1052592861 9:30520983-30521005 AGAGTTTTCTGCATTTCTTTAGG - Intergenic
1052604723 9:30684505-30684527 AGAGGTGTCTGAGGGTTTTTTGG + Intergenic
1053527724 9:38846794-38846816 AGAGGTGTCTGAATACCTTTGGG + Intergenic
1054199949 9:62071223-62071245 AGAGGTGTCTGAATACCTTTGGG + Intergenic
1054638406 9:67517134-67517156 AGAGGTGTCTGAATACCTTTGGG - Intergenic
1055931360 9:81562846-81562868 AGAGAGGCCTGCATGCCTTTTGG - Intergenic
1057051222 9:91925617-91925639 TTAGGTGTGTGCATGTATTTGGG - Intronic
1059332625 9:113545424-113545446 AGAAGAGTCTGCATCTCTTAGGG - Intronic
1059872597 9:118594612-118594634 TGAGGTTTCTACATGACTTTTGG + Intergenic
1059927406 9:119224392-119224414 AGAGTTTTCTGAATGTATTTGGG - Intronic
1061237240 9:129350296-129350318 AGGGGCGTCTTCATGTCTTATGG - Intergenic
1061809362 9:133153523-133153545 ACTGGTGGCTGCAGGTCTTTGGG + Exonic
1189134232 X:38532520-38532542 AGAGGTGCCTGCATCTCACTCGG + Intronic
1190407898 X:50105763-50105785 ACAGCTGTCTGCCTCTCTTTGGG + Intergenic
1190983449 X:55479352-55479374 AGAGGTCTGTGCATGTGTGTGGG + Intergenic
1190985250 X:55493831-55493853 AGAGGTCTGTGCATGTGTGTGGG - Intergenic
1191763346 X:64667756-64667778 AGAGGTGTTTGTATTTCTGTGGG + Intergenic
1191879042 X:65826260-65826282 AGAGGTATATTTATGTCTTTTGG - Intergenic
1194109627 X:89817562-89817584 AGAAGTTTCTGCATATCATTAGG - Intergenic
1195046442 X:101058720-101058742 TGAGATGTCTCCAGGTCTTTTGG + Intergenic
1195946182 X:110214658-110214680 AAATGTGTGTGCATGTGTTTTGG - Intronic
1197667471 X:129239385-129239407 AGAGATGTATGCATGGCTGTTGG + Intergenic
1198305037 X:135372973-135372995 AGAGCTCTCTGAATGTCTTCAGG - Intergenic
1199735425 X:150681896-150681918 TGAGGTGTCTGTTAGTCTTTTGG - Intergenic
1201336410 Y:12885403-12885425 AGAGTATTCTGCATGTCTTTTGG + Intergenic
1202269036 Y:23052892-23052914 TGGGGTTTCTGCCTGTCTTTGGG + Intergenic
1202422028 Y:24686632-24686654 TGGGGTTTCTGCCTGTCTTTGGG + Intergenic
1202448758 Y:24983446-24983468 TGGGGTTTCTGCCTGTCTTTGGG - Intergenic