ID: 1065841477

View in Genome Browser
Species Human (GRCh38)
Location 10:29704842-29704864
Sequence AAATCCCCAGGACTCCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 207}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065841477_1065841489 3 Left 1065841477 10:29704842-29704864 CCTCTCAGGAGTCCTGGGGATTT 0: 1
1: 0
2: 1
3: 16
4: 207
Right 1065841489 10:29704868-29704890 GGGGGTTGGGGAAGGGAACAGGG No data
1065841477_1065841486 -5 Left 1065841477 10:29704842-29704864 CCTCTCAGGAGTCCTGGGGATTT 0: 1
1: 0
2: 1
3: 16
4: 207
Right 1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG No data
1065841477_1065841487 -4 Left 1065841477 10:29704842-29704864 CCTCTCAGGAGTCCTGGGGATTT 0: 1
1: 0
2: 1
3: 16
4: 207
Right 1065841487 10:29704861-29704883 ATTTTCAGGGGGTTGGGGAAGGG No data
1065841477_1065841488 2 Left 1065841477 10:29704842-29704864 CCTCTCAGGAGTCCTGGGGATTT 0: 1
1: 0
2: 1
3: 16
4: 207
Right 1065841488 10:29704867-29704889 AGGGGGTTGGGGAAGGGAACAGG No data
1065841477_1065841484 -10 Left 1065841477 10:29704842-29704864 CCTCTCAGGAGTCCTGGGGATTT 0: 1
1: 0
2: 1
3: 16
4: 207
Right 1065841484 10:29704855-29704877 CTGGGGATTTTCAGGGGGTTGGG No data
1065841477_1065841485 -9 Left 1065841477 10:29704842-29704864 CCTCTCAGGAGTCCTGGGGATTT 0: 1
1: 0
2: 1
3: 16
4: 207
Right 1065841485 10:29704856-29704878 TGGGGATTTTCAGGGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065841477 Original CRISPR AAATCCCCAGGACTCCTGAG AGG (reversed) Intronic
901138754 1:7014355-7014377 AACAGCCCAGGAGTCCTGAGGGG + Intronic
901988302 1:13092676-13092698 AAATCCCGGGGACTCCGTAGGGG + Intergenic
901993510 1:13134091-13134113 AAATCCCGGGGACTCCGTAGGGG - Intergenic
903320299 1:22539077-22539099 CTATCCTCAGGGCTCCTGAGTGG - Intergenic
907348058 1:53800669-53800691 TAATCCCTAGGACTACTAAGAGG - Intronic
907713141 1:56903201-56903223 AAATCCCCACGTCTCATGGGAGG + Intronic
908445767 1:64198223-64198245 AAATCCCCAGGACGCCAAAAAGG - Intergenic
911858396 1:102912696-102912718 TAATCCCCATGTATCCTGAGAGG + Intronic
911990410 1:104689177-104689199 TAATTCCCAGGAGTCATGAGAGG - Intergenic
913971861 1:143422550-143422572 GACTCCCCAGGACCCCAGAGAGG - Intergenic
914005471 1:143729041-143729063 AAATCCTACAGACTCCTGAGGGG + Intergenic
914066240 1:144248163-144248185 GACTCCCCAGGACCCCAGAGAGG - Intergenic
914097952 1:144560300-144560322 AAATCCTACAGACTCCTGAGGGG + Intergenic
914112913 1:144718191-144718213 GACTCCCCAGGACCCCAGAGAGG + Intergenic
914875904 1:151512558-151512580 AAATCCCCAGGACAGATGAAAGG + Intronic
916266255 1:162892474-162892496 AAATCCCCAGGAATCCTGTGAGG + Intergenic
917671763 1:177280277-177280299 AAATCCCCAAGATCTCTGAGTGG - Intronic
917878951 1:179314452-179314474 AGCTCCCCAGGACTGCTGAGTGG + Intronic
918962383 1:191297421-191297443 TAACCCTCAGGACTCCTGATGGG + Intergenic
919129385 1:193434070-193434092 TAATCCCCAGGTGTCCTGAGAGG - Intergenic
921894020 1:220380255-220380277 TAATCCCCATGCATCCTGAGAGG + Intergenic
1063973613 10:11398086-11398108 TAATCCACAGGCCTCCTGTGTGG + Intergenic
1064413822 10:15131546-15131568 AAACCCCTGGGACCCCTGAGAGG + Intronic
1064489030 10:15830582-15830604 AATTCCACAGTACACCTGAGAGG + Intronic
1064708432 10:18096874-18096896 AATTCCCCATGATTACTGAGTGG - Intergenic
1065188094 10:23188578-23188600 AAGTCCCCAAGACTCCTGATGGG + Intergenic
1065841477 10:29704842-29704864 AAATCCCCAGGACTCCTGAGAGG - Intronic
1068934473 10:62622423-62622445 AAAGCCACAGGACTCCTGGCTGG - Intronic
1072270120 10:93768276-93768298 ACTTCCCCAGGACTGGTGAGTGG - Intronic
1072775509 10:98187997-98188019 ATAACCCCAGGACTTCTGGGAGG - Intronic
1072799726 10:98384701-98384723 GCATCCCCAGGCCTCCTGAAGGG + Intronic
1073177343 10:101564620-101564642 CAATCCCCAGGGAGCCTGAGAGG - Intergenic
1074774515 10:116757215-116757237 AGAACTCCAGGAATCCTGAGGGG - Intergenic
1076046540 10:127298867-127298889 CAATCCCCAGGACACCTGGGTGG - Intronic
1076473521 10:130736502-130736524 AACTCCCCAGGACTGCTCAATGG - Intergenic
1076486095 10:130818473-130818495 TAATCCCCATGAGTCCTGGGAGG - Intergenic
1076566249 10:131401367-131401389 AACCCCCCAGGGATCCTGAGGGG - Intergenic
1077308003 11:1876486-1876508 CACTCCCCAGGACCCCAGAGAGG + Intronic
1079599270 11:22291099-22291121 TAATCCCCATGTGTCCTGAGAGG + Intergenic
1081478123 11:43456865-43456887 TAATCCCCCAGACTCCTGTGTGG - Intronic
1081850822 11:46274135-46274157 AAAGTACCAGGCCTCCTGAGCGG + Intergenic
1083256604 11:61499921-61499943 ATACCCCCAGGTATCCTGAGGGG - Intergenic
1083610019 11:64000128-64000150 AGTTCCCCAGCACTCCTGTGGGG + Intronic
1085033614 11:73287427-73287449 AGATCCCCAAGACTCTAGAGGGG + Intronic
1085758849 11:79224539-79224561 AAACCCCCAGTACTGCAGAGTGG + Intronic
1088744782 11:112796264-112796286 AAATCCCCTTCACTCTTGAGGGG + Intergenic
1088837117 11:113587183-113587205 AAAGCTCCAGTGCTCCTGAGGGG + Intergenic
1091930563 12:4392279-4392301 CAAGCCCCAGGCATCCTGAGAGG - Intergenic
1092942857 12:13426758-13426780 AAATCCACAGGGTTCCTGAGAGG + Intergenic
1093779101 12:23113318-23113340 AAATCCCCTGTACTTCTGGGTGG - Intergenic
1095851391 12:46811279-46811301 AAATGCCCATGACATCTGAGGGG + Intronic
1096874040 12:54613516-54613538 AAATGGACAGGTCTCCTGAGAGG - Intergenic
1097747246 12:63315106-63315128 AATTACCCAGGACTCCTGGATGG + Intergenic
1101027831 12:100630980-100631002 GAAGCCCCAGGACTCCTTACAGG + Intergenic
1104675021 12:130706633-130706655 AAATCCTTATGGCTCCTGAGTGG - Intronic
1104979889 12:132569139-132569161 AAGTCCCCAGGAGTCAGGAGAGG - Intronic
1105213589 13:18272029-18272051 ACACCCCCAGGAGGCCTGAGTGG + Intergenic
1108716124 13:53079635-53079657 AAATCACTAGCACTGCTGAGAGG + Intergenic
1111075721 13:83232033-83232055 AAATCACCATGTCTCCTGTGAGG - Intergenic
1111688418 13:91529757-91529779 AAATCCCCAGGACTCTTATGAGG - Intronic
1112212572 13:97394869-97394891 AAAGCTTCAGGCCTCCTGAGTGG + Intergenic
1113356745 13:109588348-109588370 AATTCTCCAGGAATCCTGTGTGG - Intergenic
1113432666 13:110264164-110264186 AATTAACCTGGACTCCTGAGGGG - Intronic
1113858938 13:113468559-113468581 AACCCCCAAGGACTCCTGACTGG + Intronic
1121443314 14:93962697-93962719 GCATCCCTGGGACTCCTGAGGGG + Intronic
1121450945 14:94007809-94007831 AGCTCCCCAGGAACCCTGAGGGG + Intergenic
1121632901 14:95433838-95433860 TTATTCTCAGGACTCCTGAGAGG + Intronic
1121673105 14:95728688-95728710 AAATCATCAAGACTGCTGAGTGG - Intergenic
1124996042 15:34723768-34723790 AACCTCCCAGGACTCCTGACTGG + Intergenic
1126585231 15:50279743-50279765 AGATGCCCAGGACCTCTGAGTGG + Intronic
1127104826 15:55602271-55602293 TAGTCCTCAGGACTCCTTAGGGG - Intergenic
1128752725 15:70160760-70160782 ATCTTCCCAGGAATCCTGAGAGG - Intergenic
1130014657 15:80177141-80177163 CTATCCAGAGGACTCCTGAGGGG + Intronic
1132109943 15:99095648-99095670 AAATCCCACGGGCTCTTGAGAGG + Intergenic
1132460433 16:51054-51076 TAATCCCCAGGTGTCCTGGGAGG - Intronic
1133618299 16:7500830-7500852 TAATCCCCATGTCTCGTGAGAGG + Intronic
1133698667 16:8288727-8288749 AAACTCCCAGGCCTCCTGGGAGG + Intergenic
1133787482 16:8984629-8984651 AAAGACCCTGGACTCCTGAGTGG + Intergenic
1135943410 16:26842457-26842479 CAATGCCCAGGACCCCTCAGAGG - Intergenic
1137524777 16:49225061-49225083 TAATCCCCAGGTGTCATGAGAGG - Intergenic
1138949136 16:61889444-61889466 AAATCCCCACTACCCATGAGAGG + Intronic
1140656680 16:77148355-77148377 ATATCCACATGCCTCCTGAGAGG + Intergenic
1140939736 16:79710182-79710204 TAATCCCCAGGTGTCATGAGAGG + Intergenic
1141154828 16:81590088-81590110 AGACCAGCAGGACTCCTGAGAGG + Intronic
1141720564 16:85753030-85753052 AAATCCCCAGTTCTCCTTTGAGG - Intergenic
1143741812 17:8959941-8959963 AAATGCAGAGGGCTCCTGAGCGG + Intronic
1149489409 17:57071842-57071864 AAATGCCCAGGGCACCGGAGGGG - Intergenic
1149958052 17:61075698-61075720 AAATCCCAAAGATTGCTGAGTGG - Intronic
1150309981 17:64120263-64120285 AATGGCCCATGACTCCTGAGGGG - Intronic
1150474850 17:65467095-65467117 CAATCTCCAGGTCTCCAGAGAGG - Intergenic
1150630993 17:66880395-66880417 AGATCCCCAGGCCACCTGATGGG + Intronic
1150772956 17:68057029-68057051 CAACCCCCAGGGCTCCTAAGTGG + Intergenic
1155878067 18:31111487-31111509 AAATCCTCAGGAGTTATGAGAGG - Intergenic
1156778008 18:40817277-40817299 AAATCTCCTGGACTCCTGGCTGG - Intergenic
1158186653 18:54779460-54779482 AAATCCCCAAGACTGCTCGGTGG + Intronic
1161262650 19:3346252-3346274 AAAGCACCAGGACTCCTGCTTGG - Intergenic
1161318866 19:3631946-3631968 CCTTCCCCAGGACCCCTGAGAGG - Exonic
1162308837 19:9892724-9892746 AATGTCCCAGGACTCATGAGGGG - Intronic
1162826278 19:13254298-13254320 AAATCCCCAGGGCTAAGGAGCGG - Intronic
1163371528 19:16903845-16903867 CCATCCCCAGGACACCTGCGTGG - Exonic
1164950603 19:32333669-32333691 AAATCACAAGGACACCTGAGGGG - Intergenic
1167673586 19:50870783-50870805 AAATCTCAAGGACTTCTGGGTGG + Intronic
925079064 2:1046860-1046882 AAATTCAGAGGACCCCTGAGAGG - Intronic
925203088 2:1984853-1984875 AAATCCCTTGGAGTCCTCAGTGG + Intronic
926056419 2:9776548-9776570 TAATTCCCAGGAGTACTGAGGGG + Intergenic
926114520 2:10204022-10204044 AAATCACAAGGACTGCTGAATGG - Intronic
926394464 2:12426910-12426932 AACTTCCCAGTACCCCTGAGGGG + Intergenic
926703220 2:15818117-15818139 AGACCCCCAAGACTCCAGAGAGG + Intergenic
927041656 2:19236766-19236788 GACTACCCAGGACTCCTGAAAGG - Intergenic
929285190 2:40127732-40127754 AAGTCCCCTGGGCTCCAGAGAGG + Intronic
933787974 2:85858915-85858937 AAATCACTAGGATTCCTTAGGGG + Intronic
934176552 2:89583482-89583504 GACTCCCCAGGACCCCAGAGAGG - Intergenic
934286862 2:91657843-91657865 GACTCCCCAGGACCCCAGAGAGG - Intergenic
934300740 2:91774717-91774739 ACACCCCCAGGAGGCCTGAGTGG - Intergenic
937866100 2:126752920-126752942 AAATCACCCTGACTCCTCAGTGG + Intergenic
938143320 2:128813373-128813395 AAATCCCCAGGAACTCTGACAGG - Intergenic
938405396 2:131030100-131030122 AAGCCCTCAGGACTCCGGAGAGG + Intronic
940329061 2:152455045-152455067 ACATCCCCAGGACTTCTGTGTGG - Intronic
944472738 2:200072308-200072330 TAATCCCCATGTGTCCTGAGAGG - Intergenic
946037703 2:216756881-216756903 AAGAGCCCAGGAGTCCTGAGTGG - Intergenic
946322673 2:218962694-218962716 GACCCCCCAAGACTCCTGAGTGG - Intergenic
946562658 2:220929698-220929720 TAATCCCCATGCGTCCTGAGAGG - Intergenic
946697045 2:222370002-222370024 AAATCCCAAGGTCTGCTGAAGGG + Intergenic
947154958 2:227153195-227153217 TAATTCCCAAGTCTCCTGAGAGG - Intronic
947670134 2:231930581-231930603 AACTCCCCAGGACTGTTTAGTGG + Intergenic
948980359 2:241491417-241491439 ATTTCCCCAGGACCCCCGAGAGG + Intronic
1168806155 20:673505-673527 ACAGCCTCAGGATTCCTGAGAGG + Intronic
1169817549 20:9673855-9673877 CAACCCCCAGCACTCCTGGGAGG + Intronic
1170785588 20:19464301-19464323 AGAGCCTCAGGAGTCCTGAGGGG - Intronic
1171380667 20:24731725-24731747 AAATGCCCAGGACTCCCCAGCGG - Intergenic
1175328401 20:58145777-58145799 AAATGGCCAGGACCACTGAGTGG + Intergenic
1176110383 20:63408161-63408183 AAGTCCCCAGGAGTCCTGGGTGG - Intronic
1180608717 22:17081783-17081805 TAATACCCAGGACTGATGAGAGG - Intergenic
1180740313 22:18048997-18049019 AAAACCCAAGGAGGCCTGAGGGG + Intergenic
1180816422 22:18792420-18792442 ACACCCCCAGGAGGCCTGAGTGG + Intergenic
1181013836 22:20057166-20057188 CAGTCCCCAGGACAGCTGAGTGG + Intronic
1181202609 22:21226752-21226774 ACACCCCCAGGAGGCCTGAGTGG + Intronic
1181699094 22:24609853-24609875 ACACCCCCAGGAGGCCTGAGTGG - Intronic
1183101564 22:35587427-35587449 AAAGCCCCAGGACTGCTGGTGGG - Intergenic
1184382279 22:44152436-44152458 AAAACCCCAAAACACCTGAGTGG + Intronic
1203224304 22_KI270731v1_random:68661-68683 ACACCCCCAGGAGGCCTGAGTGG - Intergenic
1203266522 22_KI270734v1_random:18131-18153 ACACCCCCAGGAGGCCTGAGTGG + Intergenic
950163993 3:10779997-10780019 ATATCCCCTGGACTCATGGGTGG + Intergenic
950510281 3:13421420-13421442 AAAGCCCCATGATCCCTGAGGGG - Intergenic
953184588 3:40626207-40626229 ACCTCCCCAGGACTCCACAGAGG - Intergenic
953417845 3:42733079-42733101 AAATCCACAGGACTGCTGCAAGG - Intronic
957921035 3:86748696-86748718 AAATCCCCATGTGTCCTGGGAGG + Intergenic
960977335 3:123187946-123187968 AAATCCCCAGGACTGTGGAGGGG - Intronic
961310164 3:125992128-125992150 AAGACACCATGACTCCTGAGTGG - Intergenic
961638166 3:128347083-128347105 AATTCCTAAGGACTGCTGAGAGG - Intronic
962093383 3:132268870-132268892 AAACCCCCAGGCCTTCTAAGAGG + Intronic
962621759 3:137187280-137187302 ATATCCCCAACAGTCCTGAGTGG - Intergenic
962996305 3:140632347-140632369 AAATACCTAGGATTCCTCAGAGG + Intergenic
965306369 3:167069085-167069107 AAATCTCAAGAACTGCTGAGTGG + Intergenic
966944608 3:184769072-184769094 AAACCCCCAGGACACCGGCGTGG + Intergenic
970447128 4:16133620-16133642 AGATCCCCAGTGCTCCTGTGTGG + Intergenic
971293620 4:25369327-25369349 AACTCCCCATGTCTCCAGAGAGG - Exonic
976528963 4:86128337-86128359 TAATCCCCACGTGTCCTGAGAGG + Intronic
976658652 4:87516187-87516209 AAATGCGCAGGACACGTGAGTGG + Intronic
977895524 4:102360697-102360719 CAATGCCCAGTGCTCCTGAGAGG - Intronic
979839859 4:125424224-125424246 TAATCCCCATGTGTCCTGAGAGG + Intronic
980330324 4:131403042-131403064 TGATCCCCATGACTCCTGACAGG - Intergenic
980399784 4:132267273-132267295 AAATCCCCTGCATACCTGAGTGG + Intergenic
982049267 4:151484199-151484221 TTATCCCCAGGATTCATGAGTGG - Intronic
983937611 4:173513277-173513299 CAATCCCTAGGACTCCAGATTGG - Intergenic
985340789 4:188951052-188951074 AAATCCACAGGACTTCCTAGTGG + Intergenic
985666353 5:1183490-1183512 AAATCCCCAGGAGCCCTGGACGG + Intergenic
985958245 5:3280626-3280648 TCATCCCCAGGAATCCTGAACGG - Intergenic
986510613 5:8502890-8502912 AACTCCACAGGATTCCTGAGTGG + Intergenic
988019829 5:25608346-25608368 TAAAACCCAGGATTCCTGAGGGG - Intergenic
988263378 5:28920423-28920445 AAATCCCCATGTGTCCTGGGAGG + Intergenic
988907579 5:35805039-35805061 TAATCCCCAAGATTCCTGGGTGG + Intronic
989424588 5:41281229-41281251 AAATCCCCACGTGTCGTGAGAGG + Intergenic
994648645 5:102499861-102499883 AAATCCACAGGAATCCTAGGAGG + Intergenic
995688334 5:114796003-114796025 AAATCCCCAGGATGAGTGAGGGG + Intergenic
999028416 5:148261838-148261860 AAGTCACTAGGACTCCTGAATGG - Intergenic
999435052 5:151557245-151557267 CAAACCCCAGTTCTCCTGAGGGG + Intronic
999718657 5:154382147-154382169 GCATACCCAGGGCTCCTGAGAGG + Intronic
1002039695 5:176503698-176503720 AAATCTCCAGGTCCCATGAGTGG + Intronic
1003159810 6:3625256-3625278 AATTCCCTTGGGCTCCTGAGTGG - Intergenic
1004273533 6:14215251-14215273 AGAGCCCCAGGATTCCTCAGAGG - Intergenic
1004400845 6:15287289-15287311 AAATACCCAGGATTACAGAGGGG + Intronic
1007289614 6:40775530-40775552 AAATCCCCAGGAGTGCTCACAGG - Intergenic
1007315538 6:40985717-40985739 AAGTCCCCAGGAGACCAGAGTGG + Intergenic
1007411817 6:41668039-41668061 AACTCTCAAGGACTCCAGAGTGG + Intergenic
1008257385 6:49320586-49320608 AAATCCTCAAGACTTCAGAGTGG + Intergenic
1009584851 6:65587341-65587363 TAATCCCCAGGTATCGTGAGAGG + Intronic
1009614949 6:65991681-65991703 TAATCCCCACGTCTCATGAGAGG - Intergenic
1010473072 6:76252597-76252619 AACTCGCCAGAACTCCCGAGTGG + Intergenic
1014791351 6:125675953-125675975 AGATCCAAAGAACTCCTGAGTGG + Intergenic
1015154406 6:130075521-130075543 TAATCCCCACGACACCTGATGGG - Intronic
1017196107 6:151702234-151702256 AAATCCCCAAGTCTACTGTGTGG + Intronic
1018054779 6:160042337-160042359 AAAACCCCATGACTCATCAGTGG - Intronic
1018231695 6:161681977-161681999 AAGTCTCCTGGACTCCTGAGAGG + Intronic
1019831550 7:3335943-3335965 AAGTCCCCAGGACTCTAGAGTGG - Intronic
1020634516 7:10680290-10680312 AGGGCCCCAGGAATCCTGAGAGG - Intergenic
1021537649 7:21723545-21723567 AAATCACCCTGACTGCTGAGTGG - Intronic
1021574188 7:22092678-22092700 AATCCCCCAGCACTTCTGAGAGG + Intergenic
1022054963 7:26720847-26720869 AAATCCCCATGTGTCCTGGGAGG - Intronic
1022115096 7:27254102-27254124 AAATCACCAGGATTCAGGAGGGG - Intergenic
1022250425 7:28601762-28601784 CAATCTCCAAGACTGCTGAGTGG - Intronic
1022495296 7:30849414-30849436 ATATTCCCAGGACTCCTTCGAGG - Intronic
1023870488 7:44260746-44260768 AAAACCCCAGGACTCTTAAGTGG - Intronic
1027738090 7:81961198-81961220 AATGCCACAGGATTCCTGAGAGG - Intronic
1027864502 7:83629265-83629287 TGATCCCCAGGCCTCCTGATGGG - Intronic
1031521776 7:122776138-122776160 TAATCCCCAGGTGTCATGAGAGG + Intronic
1035336253 7:158128838-158128860 AAGTCCCCAGGACACCTGCAGGG + Intronic
1035773455 8:2168880-2168902 GATTCCCCAGGAGTCCTGTGAGG - Intergenic
1036646078 8:10612022-10612044 AAGTGCCGAGGCCTCCTGAGCGG - Exonic
1037630579 8:20651924-20651946 AAATCCCCCAGCCTTCTGAGTGG - Intergenic
1037885932 8:22596360-22596382 AAACCCTCAGGACCCCTGGGAGG - Intronic
1041433966 8:57817464-57817486 AGATCCCCAGATCTACTGAGTGG - Intergenic
1045420704 8:102012075-102012097 AAGTACCCAGGACTCCTTCGGGG - Intronic
1045884562 8:107079968-107079990 TAATCCCCACGTGTCCTGAGAGG - Intergenic
1050585045 9:7101885-7101907 AAATGCCCGGGGCTCCTGATAGG + Intergenic
1052447630 9:28585355-28585377 CAAGTCCCAGGACTGCTGAGAGG + Intronic
1052968968 9:34364813-34364835 TCATCCCCAGTACTCCTGAAGGG + Intergenic
1054860084 9:69942530-69942552 AAATCCACAGGGCTTCTGATAGG - Intergenic
1054863421 9:69975813-69975835 AAAACCTCAGGACTCCTGCTGGG - Intergenic
1056006528 9:82277580-82277602 TAATCCCCAGGAGTCATGGGAGG - Intergenic
1188587828 X:31799512-31799534 AAATCCCCAGGTGTCATGGGAGG - Intronic
1190101702 X:47527116-47527138 AGCTCCCCAGCACTGCTGAGTGG + Intergenic
1192150802 X:68711142-68711164 GAATCGCCAGGACCTCTGAGGGG - Intronic
1195543790 X:106092455-106092477 CAATCCCCTGGACCCCTTAGTGG + Intergenic
1200258779 X:154600442-154600464 ACATCCCAATGACTCCTGACTGG - Intergenic