ID: 1065841486

View in Genome Browser
Species Human (GRCh38)
Location 10:29704860-29704882
Sequence GATTTTCAGGGGGTTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065841471_1065841486 18 Left 1065841471 10:29704819-29704841 CCAAACCAAAAGACATGCAGACA 0: 1
1: 0
2: 1
3: 23
4: 358
Right 1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG No data
1065841472_1065841486 13 Left 1065841472 10:29704824-29704846 CCAAAAGACATGCAGACACCTCT 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG No data
1065841469_1065841486 27 Left 1065841469 10:29704810-29704832 CCTAATCTCCCAAACCAAAAGAC 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG No data
1065841470_1065841486 19 Left 1065841470 10:29704818-29704840 CCCAAACCAAAAGACATGCAGAC 0: 1
1: 1
2: 4
3: 20
4: 239
Right 1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG No data
1065841477_1065841486 -5 Left 1065841477 10:29704842-29704864 CCTCTCAGGAGTCCTGGGGATTT 0: 1
1: 0
2: 1
3: 16
4: 207
Right 1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065841486 Original CRISPR GATTTTCAGGGGGTTGGGGA AGG Intronic
No off target data available for this crispr