ID: 1065844703

View in Genome Browser
Species Human (GRCh38)
Location 10:29735497-29735519
Sequence GCCGCGCCTTTGTTACGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065844688_1065844703 27 Left 1065844688 10:29735447-29735469 CCTCCCCGAGGCGCGCTCCGGGG No data
Right 1065844703 10:29735497-29735519 GCCGCGCCTTTGTTACGGCTCGG No data
1065844691_1065844703 23 Left 1065844691 10:29735451-29735473 CCCGAGGCGCGCTCCGGGGACGG No data
Right 1065844703 10:29735497-29735519 GCCGCGCCTTTGTTACGGCTCGG No data
1065844690_1065844703 24 Left 1065844690 10:29735450-29735472 CCCCGAGGCGCGCTCCGGGGACG No data
Right 1065844703 10:29735497-29735519 GCCGCGCCTTTGTTACGGCTCGG No data
1065844693_1065844703 22 Left 1065844693 10:29735452-29735474 CCGAGGCGCGCTCCGGGGACGGA No data
Right 1065844703 10:29735497-29735519 GCCGCGCCTTTGTTACGGCTCGG No data
1065844698_1065844703 10 Left 1065844698 10:29735464-29735486 CCGGGGACGGAAGTGGGTGGGAG No data
Right 1065844703 10:29735497-29735519 GCCGCGCCTTTGTTACGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065844703 Original CRISPR GCCGCGCCTTTGTTACGGCT CGG Intronic