ID: 1065847485

View in Genome Browser
Species Human (GRCh38)
Location 10:29758040-29758062
Sequence GAGCTGACTCACCCTCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065847485_1065847489 0 Left 1065847485 10:29758040-29758062 CCCACCTGAGGGTGAGTCAGCTC No data
Right 1065847489 10:29758063-29758085 TGCTCCCCTGGCTCTCACCGCGG No data
1065847485_1065847494 19 Left 1065847485 10:29758040-29758062 CCCACCTGAGGGTGAGTCAGCTC No data
Right 1065847494 10:29758082-29758104 GCGGCTGTTATAGCATTTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065847485 Original CRISPR GAGCTGACTCACCCTCAGGT GGG (reversed) Intergenic
No off target data available for this crispr