ID: 1065854480

View in Genome Browser
Species Human (GRCh38)
Location 10:29818872-29818894
Sequence TGCTGTGTGTTCTCACCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065854480_1065854484 1 Left 1065854480 10:29818872-29818894 CCGCCAGGTGAGAACACACAGCA No data
Right 1065854484 10:29818896-29818918 TCAAGGTGCCATCTTGGAAGTGG No data
1065854480_1065854483 -5 Left 1065854480 10:29818872-29818894 CCGCCAGGTGAGAACACACAGCA No data
Right 1065854483 10:29818890-29818912 CAGCATTCAAGGTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065854480 Original CRISPR TGCTGTGTGTTCTCACCTGG CGG (reversed) Intergenic
No off target data available for this crispr