ID: 1065854483

View in Genome Browser
Species Human (GRCh38)
Location 10:29818890-29818912
Sequence CAGCATTCAAGGTGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065854478_1065854483 0 Left 1065854478 10:29818867-29818889 CCCTTCCGCCAGGTGAGAACACA No data
Right 1065854483 10:29818890-29818912 CAGCATTCAAGGTGCCATCTTGG No data
1065854476_1065854483 17 Left 1065854476 10:29818850-29818872 CCTCTTTGTCTTTCTGTCCCTTC No data
Right 1065854483 10:29818890-29818912 CAGCATTCAAGGTGCCATCTTGG No data
1065854475_1065854483 26 Left 1065854475 10:29818841-29818863 CCAGATAGGCCTCTTTGTCTTTC No data
Right 1065854483 10:29818890-29818912 CAGCATTCAAGGTGCCATCTTGG No data
1065854481_1065854483 -8 Left 1065854481 10:29818875-29818897 CCAGGTGAGAACACACAGCATTC No data
Right 1065854483 10:29818890-29818912 CAGCATTCAAGGTGCCATCTTGG No data
1065854479_1065854483 -1 Left 1065854479 10:29818868-29818890 CCTTCCGCCAGGTGAGAACACAC No data
Right 1065854483 10:29818890-29818912 CAGCATTCAAGGTGCCATCTTGG No data
1065854480_1065854483 -5 Left 1065854480 10:29818872-29818894 CCGCCAGGTGAGAACACACAGCA No data
Right 1065854483 10:29818890-29818912 CAGCATTCAAGGTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065854483 Original CRISPR CAGCATTCAAGGTGCCATCT TGG Intergenic
No off target data available for this crispr