ID: 1065859042

View in Genome Browser
Species Human (GRCh38)
Location 10:29855555-29855577
Sequence CACTTGAATCCAGGCGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065859042_1065859045 17 Left 1065859042 10:29855555-29855577 CCTCTGTCGCCTGGATTCAAGTG No data
Right 1065859045 10:29855595-29855617 TTCCGAGTAGCTGAGACTACAGG 0: 71
1: 3559
2: 73477
3: 206208
4: 276773

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065859042 Original CRISPR CACTTGAATCCAGGCGACAG AGG (reversed) Intergenic
No off target data available for this crispr