ID: 1065859988

View in Genome Browser
Species Human (GRCh38)
Location 10:29864479-29864501
Sequence GTTGGATTGCCGAGAGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065859988_1065859993 17 Left 1065859988 10:29864479-29864501 CCTGGTTCTCTCGGCAATCCAAC No data
Right 1065859993 10:29864519-29864541 TGCACCCCTCTGCCAAGTGAGGG No data
1065859988_1065859992 16 Left 1065859988 10:29864479-29864501 CCTGGTTCTCTCGGCAATCCAAC No data
Right 1065859992 10:29864518-29864540 ATGCACCCCTCTGCCAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065859988 Original CRISPR GTTGGATTGCCGAGAGAACC AGG (reversed) Intergenic
No off target data available for this crispr