ID: 1065868328

View in Genome Browser
Species Human (GRCh38)
Location 10:29933677-29933699
Sequence CTAGCACTAGAACACTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065868323_1065868328 14 Left 1065868323 10:29933640-29933662 CCTTTATGAAACCATCAGATCTC 0: 168
1: 3783
2: 6040
3: 5362
4: 3452
Right 1065868328 10:29933677-29933699 CTAGCACTAGAACACTGTGGGGG No data
1065868324_1065868328 3 Left 1065868324 10:29933651-29933673 CCATCAGATCTCATGAAACATAT No data
Right 1065868328 10:29933677-29933699 CTAGCACTAGAACACTGTGGGGG No data
1065868322_1065868328 15 Left 1065868322 10:29933639-29933661 CCCTTTATGAAACCATCAGATCT 0: 90
1: 2855
2: 6975
3: 6497
4: 4713
Right 1065868328 10:29933677-29933699 CTAGCACTAGAACACTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065868328 Original CRISPR CTAGCACTAGAACACTGTGG GGG Intergenic
No off target data available for this crispr