ID: 1065869005

View in Genome Browser
Species Human (GRCh38)
Location 10:29940207-29940229
Sequence CTTGGTTACTTCTTGGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065869005_1065869012 24 Left 1065869005 10:29940207-29940229 CCATGAACCAAGAAGTAACCAAG No data
Right 1065869012 10:29940254-29940276 ATCTACCATTGCCTTGGTCTTGG No data
1065869005_1065869011 18 Left 1065869005 10:29940207-29940229 CCATGAACCAAGAAGTAACCAAG No data
Right 1065869011 10:29940248-29940270 CACTGAATCTACCATTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065869005 Original CRISPR CTTGGTTACTTCTTGGTTCA TGG (reversed) Intergenic
No off target data available for this crispr