ID: 1065869989

View in Genome Browser
Species Human (GRCh38)
Location 10:29947911-29947933
Sequence GGGTGGCTCAATGCAACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065869982_1065869989 23 Left 1065869982 10:29947865-29947887 CCAAATAGTTGTACTTATCCTGA No data
Right 1065869989 10:29947911-29947933 GGGTGGCTCAATGCAACTGATGG No data
1065869980_1065869989 28 Left 1065869980 10:29947860-29947882 CCTGCCCAAATAGTTGTACTTAT No data
Right 1065869989 10:29947911-29947933 GGGTGGCTCAATGCAACTGATGG No data
1065869983_1065869989 5 Left 1065869983 10:29947883-29947905 CCTGAGCTGCTGATTCACCTTGT No data
Right 1065869989 10:29947911-29947933 GGGTGGCTCAATGCAACTGATGG No data
1065869981_1065869989 24 Left 1065869981 10:29947864-29947886 CCCAAATAGTTGTACTTATCCTG No data
Right 1065869989 10:29947911-29947933 GGGTGGCTCAATGCAACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065869989 Original CRISPR GGGTGGCTCAATGCAACTGA TGG Intergenic
No off target data available for this crispr