ID: 1065875388

View in Genome Browser
Species Human (GRCh38)
Location 10:29993357-29993379
Sequence CCCCCAGCGCTCCCCAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065875374_1065875388 14 Left 1065875374 10:29993320-29993342 CCAGAGGGCCCCCTCCCTACCAT No data
Right 1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG No data
1065875383_1065875388 -5 Left 1065875383 10:29993339-29993361 CCATGACACCGGGCTCCACCCCC No data
Right 1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG No data
1065875379_1065875388 4 Left 1065875379 10:29993330-29993352 CCCTCCCTACCATGACACCGGGC No data
Right 1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG No data
1065875380_1065875388 3 Left 1065875380 10:29993331-29993353 CCTCCCTACCATGACACCGGGCT No data
Right 1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG No data
1065875381_1065875388 0 Left 1065875381 10:29993334-29993356 CCCTACCATGACACCGGGCTCCA No data
Right 1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG No data
1065875382_1065875388 -1 Left 1065875382 10:29993335-29993357 CCTACCATGACACCGGGCTCCAC No data
Right 1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG No data
1065875375_1065875388 6 Left 1065875375 10:29993328-29993350 CCCCCTCCCTACCATGACACCGG No data
Right 1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG No data
1065875377_1065875388 5 Left 1065875377 10:29993329-29993351 CCCCTCCCTACCATGACACCGGG No data
Right 1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065875388 Original CRISPR CCCCCAGCGCTCCCCAGGAC AGG Intergenic
No off target data available for this crispr