ID: 1065875440

View in Genome Browser
Species Human (GRCh38)
Location 10:29993617-29993639
Sequence TTCTCTCCTTTGTTTCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065875440_1065875444 0 Left 1065875440 10:29993617-29993639 CCAGGATGAAACAAAGGAGAGAA No data
Right 1065875444 10:29993640-29993662 GCTTTGAGACTGGCTGTGGCGGG No data
1065875440_1065875445 3 Left 1065875440 10:29993617-29993639 CCAGGATGAAACAAAGGAGAGAA No data
Right 1065875445 10:29993643-29993665 TTGAGACTGGCTGTGGCGGGAGG No data
1065875440_1065875442 -4 Left 1065875440 10:29993617-29993639 CCAGGATGAAACAAAGGAGAGAA No data
Right 1065875442 10:29993636-29993658 AGAAGCTTTGAGACTGGCTGTGG No data
1065875440_1065875443 -1 Left 1065875440 10:29993617-29993639 CCAGGATGAAACAAAGGAGAGAA No data
Right 1065875443 10:29993639-29993661 AGCTTTGAGACTGGCTGTGGCGG No data
1065875440_1065875441 -10 Left 1065875440 10:29993617-29993639 CCAGGATGAAACAAAGGAGAGAA No data
Right 1065875441 10:29993630-29993652 AAGGAGAGAAGCTTTGAGACTGG No data
1065875440_1065875446 17 Left 1065875440 10:29993617-29993639 CCAGGATGAAACAAAGGAGAGAA No data
Right 1065875446 10:29993657-29993679 GGCGGGAGGTGTCCCTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065875440 Original CRISPR TTCTCTCCTTTGTTTCATCC TGG (reversed) Intergenic
No off target data available for this crispr