ID: 1065879618

View in Genome Browser
Species Human (GRCh38)
Location 10:30027567-30027589
Sequence CAGCAGCAGCAGCAGCAGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1975
Summary {0: 2, 1: 23, 2: 139, 3: 383, 4: 1428}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065879618_1065879619 10 Left 1065879618 10:30027567-30027589 CCTCACTGCTGCTGCTGCTGCTG 0: 2
1: 23
2: 139
3: 383
4: 1428
Right 1065879619 10:30027600-30027622 TGCTGCTTTCTTCCTCTTCCTGG 0: 1
1: 0
2: 4
3: 61
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065879618 Original CRISPR CAGCAGCAGCAGCAGCAGTG AGG (reversed) Exonic
900091953 1:924508-924530 CAGCGGCGGCAGCGGCAGCGCGG - Intergenic
900110754 1:1004535-1004557 CAGAAGCAGCAGCACCAGGCTGG + Intergenic
900137287 1:1123023-1123045 CAACAGCAACCGCAGAAGTGTGG - Intergenic
900161361 1:1225516-1225538 CAGCAGCCGCAGCAGCCCAGAGG + Intronic
900237557 1:1599986-1600008 CAGCAGCAGCAGCAGCGGCGGGG + Exonic
900352071 1:2239884-2239906 ACGCAGCTGAAGCAGCAGTGGGG - Intronic
900394026 1:2445732-2445754 GAACTCCAGCAGCAGCAGTGAGG - Intronic
900504875 1:3024959-3024981 CGCCCCCAGCAGCAGCAGTGAGG - Intergenic
900566814 1:3337384-3337406 CAGCCTCAGGAGCAGCAGTTGGG - Intronic
900661945 1:3789154-3789176 CTGCAGCACCAGGAACAGTGCGG + Intronic
900895296 1:5479106-5479128 CAGCAGCAGCACAGGCAGGGAGG - Intergenic
901018028 1:6242683-6242705 CAGCGGCAACAGCAGCTCTGGGG - Intergenic
901084524 1:6602545-6602567 CAGCAGCAGCTGCAGCATGTCGG + Exonic
901104859 1:6747228-6747250 CAGCAGCAGGAGATGCAGCGGGG + Intergenic
901132975 1:6974170-6974192 CTGCAGCAGCATCTCCAGTGAGG + Intronic
901604731 1:10450237-10450259 GAGCAGCAGCAGCAGGAGGCCGG - Exonic
901630895 1:10647694-10647716 CAGCAGCACCATCCGCAGTGAGG + Intronic
902066208 1:13690303-13690325 CAGCAGCAGGAGGAGCAATTAGG + Intergenic
902150763 1:14441380-14441402 CAGCAGCAGCAGCAGCACCTGGG + Intergenic
902489361 1:16769808-16769830 CAGCAGGAGCAGCAGCTTTTGGG - Intronic
902597024 1:17516526-17516548 CAGCAGCAGCAGCAGAGGTCAGG - Intergenic
902609949 1:17591179-17591201 CAGCACCATCAGCACCAGTGAGG - Intronic
902783922 1:18721025-18721047 CGGGAGCAGCAGCAGCAGGCAGG + Intronic
902847243 1:19121361-19121383 GAGCAGTTGCAGCAGCACTGGGG + Exonic
902954638 1:19917157-19917179 CAGCCGCAGAAGCAGCAGCAGGG - Intergenic
902984456 1:20147158-20147180 CAGCAGCAGCTGCAGCACCCAGG + Intronic
903057384 1:20645616-20645638 CAGCTGCAGCAGCATCATGGCGG - Exonic
903057385 1:20645619-20645641 CAGCAGCTGCAGCAGCATCATGG - Exonic
903190617 1:21653672-21653694 TAGTAGCAGCAGCAGCAGCAGGG + Intronic
903296484 1:22346589-22346611 CAGCTGCAGCAGCAGAAGCTGGG - Intergenic
903302043 1:22386129-22386151 CATCATCAGCAGCAGGGGTGTGG - Intergenic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903413811 1:23168224-23168246 CAGCAGCAGGAGGAGGAGGGCGG - Intronic
903510073 1:23868227-23868249 GAGCAGCAGCAGCAACAGCGCGG + Exonic
903575795 1:24339019-24339041 ATGAAGCAGCAGCAGCAGTATGG - Intronic
904028862 1:27521553-27521575 CATCAGCAGCAGCAGCAGCAGGG - Intergenic
904360122 1:29965733-29965755 CAGGAGCAGCCCCAGCAGGGTGG + Intergenic
904383012 1:30124238-30124260 CAGCAGCATCCACATCAGTGGGG + Intergenic
904413070 1:30336706-30336728 CAGGCCCGGCAGCAGCAGTGGGG + Intergenic
904591812 1:31619165-31619187 CAGGAGCCGCTGCAGCAGAGGGG - Exonic
904642018 1:31938178-31938200 CCGCAGCAGCAGCAGCAAGACGG - Exonic
904797857 1:33070958-33070980 CAGCAGCAGCAGCTGGAGAAAGG + Intronic
904961963 1:34340425-34340447 CAGCAGCAACAGCAGCACAGGGG - Intergenic
904974065 1:34442572-34442594 CAGCAGCATCAGCATCACTTGGG - Intergenic
904986176 1:34550349-34550371 TAACAGCAGCTGCAGCACTGTGG - Intergenic
905172090 1:36115367-36115389 CGGCAGCAGCGGCAGCAGGAGGG + Intronic
905387112 1:37612792-37612814 CAGCAACAGCAGCAGCAGCAAGG - Exonic
905534398 1:38708949-38708971 GAGCAGCAGCAGCAGCATCGCGG - Intergenic
905560873 1:38926330-38926352 GTTCAGCAGCAGCAGCACTGAGG + Exonic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
905824073 1:41016137-41016159 CAGCAGCAGCTGCAGCAGCACGG - Exonic
906003730 1:42449913-42449935 CAGCTGCAGCAGCGGCAGGTAGG - Exonic
906052714 1:42888035-42888057 CACGAGCAGCAGCAGCAGGAAGG + Intergenic
906124443 1:43418838-43418860 GAGCAGCAGCAGGAGGAGGGTGG + Intronic
906193733 1:43915663-43915685 GAGCAGCATCAGCAAAAGTGTGG + Intronic
906209680 1:44005595-44005617 CAGCAACAGCAGCACCAGACGGG + Intronic
906345211 1:45010570-45010592 CAGCGGCAGCAGCAGCTCTTTGG - Exonic
906573109 1:46861966-46861988 CAACAGCAGCAGCAGCTGTTGGG - Intergenic
906587711 1:46994416-46994438 CAGAAGCAGGCTCAGCAGTGAGG + Intergenic
906678951 1:47712025-47712047 CAGCATCAACAGAAGCAATGCGG + Intergenic
906964084 1:50439613-50439635 CAGGAACAGCAGCAGGGGTGTGG - Exonic
907175711 1:52520440-52520462 CAGCAGCATCAGCATCACTTGGG + Intronic
907280385 1:53343326-53343348 CAGCAGCAGAGCCAGCAATGAGG - Intergenic
907306900 1:53518247-53518269 GAGCAGCACTAGCAGCAGGGAGG + Intronic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
907534500 1:55137544-55137566 CTCCAGCAGCAGCAGCAGTGGGG - Exonic
907868606 1:58422854-58422876 CAGCAGAAGCAGCAGAAGCAAGG + Intronic
908102699 1:60807863-60807885 TAGCAGCAGCAGCTGCAGGCAGG + Intergenic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908556273 1:65259709-65259731 CAGCAGCATCAGCATCACTCAGG + Intronic
908644707 1:66265096-66265118 CAGCAGCATCAGCACCACTTGGG + Intronic
908667708 1:66510715-66510737 CAGCAGCCTCAGTGGCAGTGGGG - Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
908854110 1:68405321-68405343 CAGCAGCAGCAGCAGCAATACGG + Intergenic
908932548 1:69334412-69334434 CAGGATCAGCAGTGGCAGTGTGG + Intergenic
908959625 1:69680116-69680138 CAGCAGCAGCAGCAGCATCTGGG + Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909666659 1:78141937-78141959 CAGCAGGTGAAGGAGCAGTGAGG - Intergenic
909678406 1:78263724-78263746 CAGCAGCAATAGCAGCACAGTGG - Intergenic
909980637 1:82096096-82096118 CAGCAGCAGCAGCATCACCTGGG - Intergenic
910171862 1:84386495-84386517 CAGCAGCAGAGGTAGCAGAGGGG + Intronic
910186884 1:84552357-84552379 CAGCAGCATTAGCATCAGTTGGG - Exonic
910364216 1:86446745-86446767 AAGGAGCAGCAGCAGAAGTCAGG + Intronic
910674101 1:89800008-89800030 TTGCAGCAGCAGCAGCAAAGGGG + Intronic
911103488 1:94111902-94111924 AAGCAGCAGCAGCAACTGCGTGG - Intronic
911539847 1:99145418-99145440 CAACAGCAGCAGGAGCACAGTGG - Intergenic
911660769 1:100499118-100499140 CAGAAGCAGCAACAGCAACGGGG + Exonic
912318975 1:108692658-108692680 GCTCAGCAACAGCAGCAGTGCGG + Exonic
912494310 1:110081611-110081633 CAGCAGCAGAAGCAACAGCTAGG + Intergenic
912515030 1:110211748-110211770 CAGCGGCAGCAGCGGCGGCGGGG + Exonic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
912721541 1:112024600-112024622 CAGCAGCAGCAGCAGCTAATGGG - Intergenic
912776569 1:112509387-112509409 CAGCAGCAGGAGCAGAAGGCAGG - Exonic
913334712 1:117698594-117698616 CCGAAGCAGCAGCAGGAGAGAGG + Intergenic
913711322 1:121486738-121486760 GAGCAGAACCAGCAGCAATGAGG + Intergenic
914455724 1:147834544-147834566 CACCGTCAGCAGAAGCAGTGTGG - Intergenic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
915142359 1:153775505-153775527 CAGCAGGGGCAGCAGCAGGAGGG - Exonic
915319095 1:155046385-155046407 CACCACCAGCAGCAGCAGAATGG - Exonic
915325331 1:155078982-155079004 CAGCAGCGGCAGCAGCGGCACGG - Exonic
915368120 1:155326649-155326671 CAGCAGGAGCAGCAGCTCTGTGG - Exonic
915393155 1:155562436-155562458 CGGCGGCGGCAGCAGCAGAGTGG + Exonic
915409300 1:155688325-155688347 CGGCAGCGGCGGCAGCAGAGTGG + Exonic
915420515 1:155777617-155777639 CAGCAGCAGATGCAGCAGGTAGG - Exonic
915427067 1:155835709-155835731 CAGCCGCAGCAGCAGACCTGCGG - Intronic
915527885 1:156487375-156487397 CAGAAGTGGGAGCAGCAGTGGGG - Intronic
915623819 1:157102348-157102370 CAGCAGCAGCAGCATCACCTAGG - Intergenic
915779097 1:158525757-158525779 CAGCAGTATCATCAGCAGTAGGG - Intergenic
915815774 1:158963162-158963184 CTGCAGCAGCAGTGGCAGAGGGG - Intronic
915835386 1:159171782-159171804 CAGGAGCAGGAGCAGGAGCGAGG - Exonic
915837909 1:159192627-159192649 CAGCATCAGCATCAGCAATGTGG + Exonic
915913570 1:159928708-159928730 TAGCAGCAGCAGCCCCAGTGGGG - Exonic
915945660 1:160149723-160149745 CAGCAGTAACTTCAGCAGTGGGG + Intergenic
915999895 1:160605828-160605850 GAGCATCAGCTGCAGCAGTACGG + Intergenic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916059537 1:161089234-161089256 CAGTAGCAGCAGCAGCAGCCAGG + Exonic
916203626 1:162294960-162294982 CAGCAGCAGCAGCAGTGGTGAGG - Intronic
916456103 1:164972440-164972462 CAGCAGCAGAGGCAGAAGGGAGG - Intergenic
916482324 1:165225753-165225775 CAGCAGCAGCAGCATCACCTGGG - Intronic
916562609 1:165946154-165946176 CGGCAGCAGTAGCAGCAGCAAGG + Intergenic
916584251 1:166136479-166136501 CAGAGACAGCAGCAGCTGTGAGG - Intronic
916772577 1:167926606-167926628 CAGCAGCATCTGCAGCAGTTGGG - Intronic
916885241 1:169060955-169060977 CAGCAGCAACAACAGCAATAGGG + Intergenic
917208240 1:172601162-172601184 CAGCAGGAGCAGAAGCAGACAGG + Intronic
917345210 1:174022257-174022279 CAGCCTCAGCAGCAGCAGGTGGG - Exonic
917820237 1:178755340-178755362 CACCACCAGCAGGAGTAGTGAGG - Intronic
918121294 1:181543234-181543256 CAGCAGCATCAGCATCAGCAGGG - Intronic
918194768 1:182210856-182210878 CATCAGCAGAAGCAGAACTGTGG + Intergenic
918607397 1:186444882-186444904 CAGCAGCATCAGCATCACTTGGG + Intronic
918826984 1:189336888-189336910 TGCCAGCAGCAGCAGCAGTGTGG - Intergenic
919444788 1:197689481-197689503 CAGCACCAGCAGCAACAGTAAGG - Intronic
919757849 1:201077046-201077068 GAAGAGCAGCAGCAGCAGGGAGG + Exonic
919776483 1:201197427-201197449 CTGCAGCAGCGGCAGCAGCCTGG - Intronic
919787425 1:201268705-201268727 CAGCAGCAGCTGCTGCAGGGAGG + Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
919871445 1:201824793-201824815 CAGCAGCATCAGCAGCCTTTGGG + Exonic
920034453 1:203056811-203056833 CAGCAGCAGCAACAGCAGCCAGG + Exonic
920115710 1:203619652-203619674 CAGCAATAGCAGCAGCAGGCTGG - Intergenic
920178225 1:204116662-204116684 CGGCAGCAGCAGGAGCAGGTAGG + Exonic
920335349 1:205241613-205241635 CAGCAGCATCAGCAGCAGCAGGG + Exonic
920600780 1:207321821-207321843 CAGCACCAGCAGCAGCAGCCGGG - Exonic
920662176 1:207924540-207924562 CAGCAGCAGCAGCATCACCTGGG - Intergenic
920857597 1:209675627-209675649 CAGGAGGAGCAGCAGGAGAGGGG - Intronic
920866606 1:209758680-209758702 GAGAAGCAGCAGCAGCTGTGAGG + Exonic
920876244 1:209838877-209838899 CAGCAACAGCAGCCTTAGTGGGG - Intronic
921104270 1:211959964-211959986 CAGCAGCAACAGCAGCATAACGG - Intronic
921132687 1:212233171-212233193 CAGCAGCAGCAGCATCACCTGGG - Intergenic
921263747 1:213405656-213405678 CAGCAGTAGCAGCAGCAATCTGG + Intergenic
921291822 1:213664490-213664512 CAGTAGCAGCTGCAGCAGAAGGG - Intergenic
921395132 1:214661105-214661127 CAGCAGATTCAACAGCAGTGAGG - Intronic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921812362 1:219529419-219529441 GAGCAGCAGCAGCAGCAGCAGGG + Intergenic
921945694 1:220884563-220884585 TAGTAGCAGCAGCACCAGTGCGG + Exonic
922167434 1:223127897-223127919 AAGCAGCAGCAGCAGCACCTGGG + Intronic
922180231 1:223227650-223227672 CAGCAGCACCAGCAGCACACTGG + Exonic
922327741 1:224544669-224544691 CAGCAGCCTCAGCAGCACAGCGG - Intronic
922466269 1:225847131-225847153 CAGCAGCAGCAGCAGACCTATGG - Exonic
922821689 1:228489027-228489049 CAGAGTCAGCAGCTGCAGTGTGG + Exonic
922872322 1:228912842-228912864 CAGCAGCAGCAGCAGCTATGTGG - Intergenic
922969621 1:229725120-229725142 CAGCCGCAGCAGCAGCATCTGGG - Intergenic
923119712 1:230978802-230978824 CAGCAGCAGCAGCAGCCGGCAGG + Exonic
923256583 1:232226640-232226662 CAGCAACAGCAGCAGCAGCCTGG + Intergenic
923506290 1:234609196-234609218 TTGCAGCAGCAGCAGCAGCTTGG - Exonic
923531077 1:234812717-234812739 CAGCAGGAGCAGCAGCTTTTGGG + Intergenic
923596053 1:235361506-235361528 CACCACCAGCAGCAACACTGTGG + Intergenic
923603618 1:235424253-235424275 TAGCAGTGGCAGCAGCAGTGCGG + Intronic
923629389 1:235639984-235640006 CAGCAGCAACGGCAGCTCTGAGG - Intronic
924052523 1:240092770-240092792 CAGCAGCAGCAGCAGCTCCAGGG + Exonic
924316823 1:242806540-242806562 CAGCAGCATCAGCATCACTTGGG - Intergenic
924331784 1:242946808-242946830 CAGAAGCAGCAGTGGCAGTATGG - Intergenic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
924567401 1:245210192-245210214 CAGCAGAAGCTGCAGCTGCGGGG - Intronic
924624259 1:245686673-245686695 CATCATCAGCAGCATCAGCGAGG + Exonic
924628678 1:245716643-245716665 CAGCAGCTGAAGCAACAGAGAGG + Intergenic
924705686 1:246500074-246500096 AAGGAGCAGCAGCAGCAGCAGGG - Intronic
924706285 1:246505432-246505454 CAGCAGCAGCAGCAGCACCAGGG + Intronic
924809754 1:247390445-247390467 CTGCAGCAGCAGCTGGAGTCGGG + Intergenic
1063149314 10:3322208-3322230 CAGAGGCAGGAGCAGCACTGGGG + Intergenic
1063308612 10:4931648-4931670 CAGCAGCAGCAGAACCTCTGTGG + Intronic
1063318059 10:5025824-5025846 CAGCAGCAGCAGAACCTCTGTGG - Intronic
1063349875 10:5344223-5344245 CAGTAGCAGCAGCAGCTGCTTGG - Intergenic
1063652217 10:7949015-7949037 CAGCAGCGGCGGCAGCAGCCGGG - Intronic
1063819755 10:9820317-9820339 CAGCAGCAGCAGGAGCTTGGTGG - Intergenic
1064107435 10:12511860-12511882 CAGCGGCATCTCCAGCAGTGGGG + Intronic
1064337957 10:14460566-14460588 AAGCAGCAACACCAGCAGAGAGG + Intronic
1064408948 10:15088740-15088762 CAACAGCAGCAGCAACAACGCGG - Exonic
1064419569 10:15179261-15179283 CAGCAGCAGCAGTATCTGTGAGG - Intergenic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1064818281 10:19292517-19292539 CAGGTGCATGAGCAGCAGTGGGG - Intronic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1065881608 10:30042268-30042290 CACCCGCAGCACCTGCAGTGGGG + Intronic
1066048282 10:31613311-31613333 CAGCAGCAACAGCAACAGCAGGG - Intergenic
1067017451 10:42768793-42768815 CAGCAACAACAGCAGCAGAAAGG - Intergenic
1067286583 10:44911736-44911758 GAGCAGCAGCAAGTGCAGTGGGG + Intronic
1067455021 10:46413022-46413044 CAGCAGAAACAGCAGAGGTGGGG - Intergenic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067632183 10:47971612-47971634 CAGCAGAAACAGCAGAGGTGGGG + Intergenic
1067691193 10:48503486-48503508 TAGCCGCAGCAGCAGGTGTGGGG - Intronic
1067724481 10:48759539-48759561 CAGCAACAGCAGCAGCAGCCAGG - Intronic
1067849580 10:49746162-49746184 CGGCAGCAGCACCAGCCGGGTGG + Intronic
1068053533 10:51982804-51982826 CAGCAGCAGCAGCAGTGTAGTGG + Intronic
1068097612 10:52511645-52511667 CAGCAGCAGCAGGACCAGAGAGG + Intergenic
1068613068 10:59082088-59082110 CAGCATCAGCAGCACCACTTGGG + Intergenic
1068657594 10:59591347-59591369 CAGCAGCAGCAGCAGCCATATGG - Intergenic
1068910525 10:62374436-62374458 CAGCAGCAGCAGCAACAAGTCGG + Exonic
1068919401 10:62466349-62466371 CACCAGCTGCTGCAGCAGAGTGG - Intronic
1069121698 10:64576500-64576522 CAGCTGCAGCTGCACCAGGGAGG - Intergenic
1069570535 10:69492114-69492136 CAGCAGGGGCAGCTCCAGTGAGG - Intronic
1069781913 10:70962240-70962262 CAGGTGCTGCAGGAGCAGTGTGG - Intergenic
1069900662 10:71704994-71705016 CATCAACAGCAGCAGCGGCGTGG + Intronic
1069916563 10:71790397-71790419 CATCAACAGCAGCACCGGTGAGG + Intronic
1069916735 10:71791186-71791208 CAGCAGCAGCAGCTCCAGGATGG - Intronic
1069921388 10:71817883-71817905 CAGCAGCAGAACCAGCTGTGGGG + Intronic
1070160772 10:73865577-73865599 CAGCAGCAGTGGCAGCAGAGGGG + Intronic
1070459724 10:76652288-76652310 TATCAGCACCAGCAGTAGTGAGG - Intergenic
1070512140 10:77171132-77171154 CAGCAGCAGCAGCATCACTTGGG + Intronic
1070527802 10:77310268-77310290 CAGCAGCAGGGGCAGCTGAGGGG - Intronic
1070570642 10:77637722-77637744 CGGCAGCAGTAGCAGCAATATGG - Intronic
1070578435 10:77698512-77698534 GAGCAGAAGCAGCAGCAATGGGG + Intergenic
1070601460 10:77869129-77869151 CAGCAGCTCCCTCAGCAGTGTGG - Exonic
1070692845 10:78540507-78540529 CAGCAGAAGCAGCTGCACAGGGG + Intergenic
1070742898 10:78914067-78914089 CACCAGCAGCGGCAGCAGCCGGG - Intergenic
1070786319 10:79164191-79164213 CAGCACCAACAGCGGCAGCGTGG + Intronic
1070938883 10:80325297-80325319 CAGCAGTAGCAGCAGCATCTGGG + Intergenic
1070994105 10:80760649-80760671 CAGCAGCAGCAGCATCACCTGGG - Intergenic
1071086739 10:81874975-81874997 CAGCAGCAGCAGCGGGCGCGGGG + Intergenic
1071358023 10:84817959-84817981 CAGCAGCAGCAGCAGCATGAGGG + Intergenic
1071397456 10:85237969-85237991 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1071444201 10:85730847-85730869 CAGCAGCAGCAGCATCACCTGGG - Intronic
1071881074 10:89898577-89898599 CACAAGCAGCAGCTCCAGTGGGG + Intergenic
1071882106 10:89910894-89910916 CAGCAGCAGCAGTGGCAGCATGG + Intergenic
1071882107 10:89910897-89910919 CAGCAGCAGTGGCAGCATGGTGG + Intergenic
1072047590 10:91672226-91672248 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1072270741 10:93773983-93774005 CAACAGCAGCAGCATCATGGAGG - Intronic
1072336611 10:94403285-94403307 CAGCAGCTGCAGCAGTAGCGAGG + Exonic
1072540170 10:96392529-96392551 CACCAGCAGCACCAGCAGTAAGG + Intronic
1072562199 10:96586773-96586795 CAGCAGCAGCAGCCACAGCGCGG + Exonic
1072642703 10:97224523-97224545 CAGCAGCAAAAGCAGCAGAAAGG + Exonic
1072688072 10:97550498-97550520 CAGCTCCTGCAGCAGCAGGGAGG - Intronic
1072733748 10:97865655-97865677 CAGTGGCAGCAGCAGCGGTGGGG + Exonic
1072919200 10:99561346-99561368 CAGCAGGAAGAGAAGCAGTGGGG - Intergenic
1073100780 10:101005546-101005568 CTGCAGCTGCAGCAGCTGTTGGG - Exonic
1073101827 10:101010530-101010552 CAGCCGCAGCCGCAGCAGCCGGG - Intronic
1073104238 10:101023192-101023214 CAGCAGGAGCAGCGGCAATGTGG + Intronic
1073204739 10:101762917-101762939 CTGCAGCAGCCACAGCACTGTGG - Intergenic
1073535094 10:104269183-104269205 CGGCGGCAGCAGCAGCAAGGAGG - Exonic
1073868308 10:107830663-107830685 CAGCAGCTGCAGGGGCACTGCGG + Intergenic
1073912597 10:108363782-108363804 CAGCAGGAACAGCAGCTGGGGGG + Intergenic
1074524877 10:114254510-114254532 TAGCAGTAACAGCAGCAATGTGG - Intronic
1074722673 10:116276182-116276204 CATAAGCAGCAGCAGTACTGGGG + Intergenic
1074944890 10:118271758-118271780 CCTCAGCAGAAGCAGCAGGGAGG - Intergenic
1075164148 10:120051835-120051857 AAGCAGCAGGAGCAGGTGTGGGG + Intergenic
1075233933 10:120709660-120709682 AAGCACCAGCAGCTGTAGTGAGG - Intergenic
1075347115 10:121691213-121691235 AAAGAGCATCAGCAGCAGTGGGG - Intergenic
1075438470 10:122461669-122461691 CAGCAGCAGCGGGAGAAGAGCGG - Exonic
1075486884 10:122829650-122829672 AAGCAGCTGCAGCAGCAGCAGGG - Intergenic
1075534432 10:123258116-123258138 CAGCTGGAGCAGCAGCGGCGAGG - Intergenic
1075651301 10:124129568-124129590 CAGAGGCAGCAGCTGCAGAGTGG - Intergenic
1075818107 10:125281969-125281991 AAGCAGCAGCAACAGCCTTGTGG - Intergenic
1075969693 10:126642050-126642072 CAGCAGCAGCTCCATCAGTGGGG - Intronic
1076136313 10:128047426-128047448 CAGCAGCGGCAGTAGCAGCCAGG - Exonic
1076140872 10:128077734-128077756 CAGAAGCAGCAGCAGCAGACAGG + Exonic
1076163394 10:128263278-128263300 CACCAGCTGCAGTGGCAGTGGGG - Intergenic
1076169599 10:128308304-128308326 CAGCTGCAGCTGGAGCAGCGGGG - Intergenic
1076331794 10:129675704-129675726 CAGCAGCAGCAGTGGGTGTGTGG - Intronic
1076372957 10:129966865-129966887 GGGCAGGAGCAGCAGCAGAGGGG + Intergenic
1076474720 10:130744063-130744085 TAGCAGCATCAGCAACAGGGAGG - Intergenic
1076549717 10:131270619-131270641 CAGCAACGGCAGCAGCCATGCGG - Intronic
1076580222 10:131503031-131503053 GAGCAGCAGCTGCAGGAGTTTGG + Intergenic
1076775241 10:132692007-132692029 CAGCAGCAACACCTGCCGTGTGG - Intronic
1076814936 10:132909944-132909966 CAGCTGCTGCAGCAGCAGATTGG - Exonic
1076921977 10:133459034-133459056 CAACGGCAGCAGCAGCTGTGAGG + Intergenic
1077063347 11:627108-627130 GAGCAGCAGCAGCAGCAGGAGGG + Exonic
1077103310 11:831635-831657 CAACAGCAGCAGCAGCAGGTGGG - Exonic
1077370013 11:2177445-2177467 CAGCAGCAGTAGCAGAAGGGGGG - Intergenic
1077872036 11:6270648-6270670 CAAGAGCAGAAGCAGCAGTACGG - Exonic
1077976914 11:7256292-7256314 CAGCAGCAGCAGCAGCTGCTGGG + Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078467514 11:11561154-11561176 CAGCAGCAGCAGAAACTGCGAGG + Intronic
1078514114 11:12008544-12008566 CAGCAGCAGGCACAGCAGGGTGG + Exonic
1078544571 11:12237748-12237770 CAGGAGCAGCAGCAGCAGCTGGG + Intronic
1079181380 11:18196747-18196769 CAGCAGCAGCAGTACCAGATAGG - Intronic
1079620064 11:22543135-22543157 AAGCTGCAGCAGCAGAAGTGAGG + Intergenic
1080394211 11:31875069-31875091 CAGTAGCAGGAGCAGCAGGAGGG - Intronic
1080433743 11:32221270-32221292 CAGCAGCAGGAGCAGAAGACAGG - Intergenic
1080540201 11:33257672-33257694 CAGCAGCAGCAGCAGCGGTCGGG + Exonic
1080606647 11:33869671-33869693 CAGCAGCAGCTGCAGCCGCCTGG - Intronic
1080682245 11:34487668-34487690 CAGCAGCATCAGCAGAAGGAGGG - Intronic
1080798969 11:35591624-35591646 CAGAAGCAACAGCAGCAGCATGG - Intergenic
1081083313 11:38769332-38769354 GAGCGGCAGCAGTGGCAGTGTGG - Intergenic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081812823 11:45922917-45922939 CAGCAGCAGCAACAGCGCGGCGG - Exonic
1081812824 11:45922920-45922942 CAGCAGCAGCAGCAACAGCGCGG - Exonic
1081899680 11:46617272-46617294 TAGCCGCGGCAGCGGCAGTGAGG - Intronic
1082004553 11:47412363-47412385 CTGCAGCAGCAGCAACAGCTGGG + Exonic
1082004753 11:47413414-47413436 GCGCGGCGGCAGCAGCAGTGGGG - Exonic
1082176511 11:49066254-49066276 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1082883253 11:58058754-58058776 CAGCAGCTGCAGAAGCAGATCGG - Intronic
1083271127 11:61573142-61573164 CAGCTGGAGCAGGAGCTGTGTGG + Intronic
1083297301 11:61721934-61721956 CAGCTGCACGGGCAGCAGTGTGG - Intronic
1083393284 11:62371277-62371299 CAGCAGCAGCAGCGGCGACGAGG + Intronic
1083599657 11:63939004-63939026 CAACAGCGGCGGCAGCAGAGCGG - Exonic
1083652546 11:64211617-64211639 CCGCGGCAGAAGCAGCAGTCAGG - Intronic
1083729065 11:64643300-64643322 CGGCAGCGGCAGCAGCGGCGCGG - Intronic
1083796879 11:65021967-65021989 CAGCAGTAGCAGCAGCAGGCTGG - Exonic
1083829137 11:65219923-65219945 TGGCAGCAGCAGAGGCAGTGAGG + Intergenic
1083851310 11:65369040-65369062 CAGCAGCAGCAGCAGCATCTGGG + Intergenic
1083853964 11:65383070-65383092 CAGCAGCATCAGCGGCAGCCTGG + Intronic
1084014350 11:66369809-66369831 TAGCAGCTGCTGCAGGAGTGGGG - Intronic
1084086581 11:66857749-66857771 CAGCAGCAGCAGGAGCGGCGGGG - Exonic
1084144629 11:67258159-67258181 CAGCAGCAGCAGCAGAACTAGGG + Intergenic
1084178702 11:67436228-67436250 CAGCAGCAGCAGCAGGACAACGG + Exonic
1084185086 11:67467319-67467341 CAGCAGCAGGAGCAGGAAGGAGG + Exonic
1084209045 11:67612526-67612548 CAGCAGCGGCAGCTGGAGGGTGG - Intronic
1084222853 11:67695248-67695270 AAGCAACACCAGCTGCAGTGAGG + Intergenic
1084454300 11:69258650-69258672 CAGCAGCATCAGCATCACTTGGG + Intergenic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084764967 11:71302241-71302263 CAGCAGCAGCAGTAGGAGCATGG + Intergenic
1084906179 11:72349688-72349710 CAACAGCAAAAGCTGCAGTGTGG + Intronic
1084954853 11:72685737-72685759 CAGCTGCAGCAGCTTCAGCGGGG - Intronic
1085022244 11:73217224-73217246 CACCAGGAGCAGTAGCAGAGTGG - Intergenic
1085117210 11:73940111-73940133 CAGTAGTAGTAACAGCAGTGAGG + Intergenic
1085176143 11:74489943-74489965 CAACAGCAGCAGTAGCCCTGTGG + Intergenic
1085282613 11:75340918-75340940 CAGGGCCAGCAGCAGCAGTGTGG - Intronic
1085305661 11:75484337-75484359 CAGCAGCAGCTGCACCAGAGGGG + Intronic
1085401551 11:76238810-76238832 CAGCAGCAGCAGCTTCTGTGGGG - Intergenic
1085808426 11:79658078-79658100 CAGAAGCATCAGCATCAGCGGGG + Intergenic
1085812799 11:79700630-79700652 CAGCAGCAGTGGCAGCACAGTGG - Intergenic
1086486912 11:87315117-87315139 CAGTAGCAGCAGTAGTAGGGGGG - Intronic
1086486915 11:87315120-87315142 AAGCAGTAGCAGCAGTAGTAGGG - Intronic
1086689202 11:89769621-89769643 CAGGAGCAGCAGAAGCTGTAAGG + Intergenic
1086716656 11:90070350-90070372 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1086980079 11:93186939-93186961 CAGCAACATCAGCAGCACTGGGG - Intronic
1087133852 11:94694660-94694682 CAGCTGGAGCAGCAGCAGCACGG + Intergenic
1087144649 11:94799803-94799825 CAGCAGCAGCAACAGCAGCAGGG + Exonic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1087443014 11:98208815-98208837 CAGCTGCAGCAGGAGAGGTGCGG - Intergenic
1087448829 11:98291616-98291638 CAGCAATAGCAGCAGTAGTTTGG + Intergenic
1087866243 11:103229954-103229976 CAGCAGCATCAGCATCACTTTGG + Intronic
1089278517 11:117356011-117356033 CAGCAGCAGCAACAGCAACCTGG + Intronic
1089557422 11:119321877-119321899 CAGCCCTGGCAGCAGCAGTGAGG - Intergenic
1089572440 11:119419453-119419475 CAGGAGCAGCAGCAGCCACGAGG + Exonic
1089609457 11:119661355-119661377 CAGCAGTGGCAGCAGCAGAGGGG + Exonic
1089678418 11:120105924-120105946 CAGCAACAAAAGCAGCAGTCAGG + Intergenic
1089813676 11:121153039-121153061 GAGTAGCAGCCGCAGCTGTGGGG - Exonic
1090105573 11:123851314-123851336 CAGCAGCAGCAGCTGTGTTGGGG + Intergenic
1090476987 11:127032017-127032039 CAGCAGCAGCAGCAACACCCGGG - Intergenic
1090643651 11:128749955-128749977 CAGCAGGCTCTGCAGCAGTGGGG - Intronic
1090914832 11:131154240-131154262 CAGCGGCACCAGCAGCACCGGGG - Intergenic
1090931129 11:131299069-131299091 CAGCAGCAGCAGCACCACCTGGG - Intergenic
1091097694 11:132839621-132839643 CAGCGTCAACAACAGCAGTGTGG - Intronic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091111353 11:132971930-132971952 CGGCAGCAGCAGTAGCAGCAGGG - Intronic
1091219319 11:133920796-133920818 CCTCAGCAGCAGCAGCCCTGGGG - Exonic
1091271180 11:134312978-134313000 GAGCAGCAGCACCAGCAGCAGGG - Intronic
1091293232 11:134454106-134454128 CAGCAGCAGCAGCAGAAGCAGGG - Intergenic
1091498314 12:991297-991319 CAGCAGTAGCGGCAGCCCTGAGG + Intronic
1091594335 12:1865655-1865677 CAGCAGCAGCAGCAGCACCAGGG + Intronic
1091708998 12:2724161-2724183 GAGCTGCTGCAGCAGCAGAGTGG + Intergenic
1091850398 12:3692641-3692663 CAGCAGCAGTGGCAGCAGCATGG + Intronic
1091850399 12:3692644-3692666 CAGCAGTGGCAGCAGCATGGTGG + Intronic
1092132001 12:6119255-6119277 TAAGAGCAGCAGCAGCAGTTGGG + Intronic
1092211098 12:6646996-6647018 CAGAGGCAGGAGCAGCACTGCGG + Exonic
1092257794 12:6936759-6936781 CAGCAGCAGCAGCAGCATCACGG + Exonic
1092418308 12:8308801-8308823 CAGCGGCAGCAGCAGCTGGAGGG + Intergenic
1093195474 12:16125159-16125181 TATCATCAGCAGGAGCAGTGTGG + Intergenic
1093406754 12:18813727-18813749 GGCTAGCAGCAGCAGCAGTGGGG + Intergenic
1093465022 12:19440029-19440051 CAGCAGCAGCGGCGGGGGTGAGG + Exonic
1093465045 12:19440134-19440156 CAGCAGCAGCAGCGGGGATGGGG + Exonic
1093661170 12:21758608-21758630 CAGGAGCAGCAGGAGAAGTATGG - Intergenic
1094439088 12:30455007-30455029 AAGCAGCAGCAGCAACACAGTGG - Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1095262698 12:40115571-40115593 TAGCAGCAGCAGTTGTAGTGGGG + Intergenic
1095879224 12:47114602-47114624 AAGCAGTAGCAGAAGTAGTGGGG - Intronic
1096111728 12:49032778-49032800 CAGCAGCAACAGCAGCAGATGGG - Exonic
1096111864 12:49033645-49033667 CAGCAGCAACAGCAACATTCTGG - Exonic
1096112854 12:49039519-49039541 CAGCAGCTGCAGGAGCAGTGGGG - Exonic
1096154908 12:49336457-49336479 CACCAGCAGCAGCAGCACCATGG + Exonic
1096180698 12:49548986-49549008 CAACTGCAGCAGCAGCAGCGAGG + Exonic
1096220083 12:49823594-49823616 CAACAGCAGGAGCAGCAGAATGG + Intronic
1096377930 12:51129846-51129868 AAGCAGCAGCAGCTTCATTGGGG + Intronic
1096522431 12:52191851-52191873 CAGCAGCCTCAGCAGCTGTGAGG - Exonic
1096537426 12:52284159-52284181 CAGCAGCAGCAGCCCCTGTCAGG - Intronic
1096595219 12:52690905-52690927 CAGCAGCAGGGCCAGCAGAGCGG + Exonic
1096607511 12:52777192-52777214 CAGCAGCAGGATGAGCTGTGTGG - Exonic
1096610211 12:52795946-52795968 CAGCAGCAGGATGAGCTGTGTGG - Exonic
1096647088 12:53044754-53044776 CAGCAGCAGGAGCTTCAGAGAGG - Intergenic
1096782549 12:53999536-53999558 CAGGAGCAGCAGGGGCGGTGAGG - Intronic
1096848162 12:54419109-54419131 CAACAGCAGCGGCAGCAGCGGGG + Exonic
1096863838 12:54549625-54549647 CGGCAGCAGCAGCGGCGGTGCGG + Exonic
1096872710 12:54604138-54604160 CACAAGCAGCAGCAGAAGTGTGG + Intergenic
1097053069 12:56235211-56235233 CAGGAGCCGCAGCAGCAGCAGGG - Exonic
1097053468 12:56237183-56237205 CAGCAGCAGCAGCCGCCGAAAGG - Exonic
1097173274 12:57128972-57128994 CAGCAGCAGGAGCAACGGCGGGG - Exonic
1097221885 12:57455900-57455922 CAGGAGCAGCAGAGGGAGTGGGG + Intronic
1097561249 12:61208885-61208907 CAGCAGCAGCTGCAGAACAGCGG + Intergenic
1097585481 12:61510695-61510717 CAGCAGCAGCAGGAGAAGAATGG + Intergenic
1097708715 12:62895455-62895477 CAACAGCAGCAGCAGCACCTGGG + Intronic
1097909023 12:64949271-64949293 CAGCAGCAGCAGCAGCCACATGG - Intergenic
1098704113 12:73665387-73665409 GGGCAGCGGCAGCATCAGTGTGG - Intergenic
1098893277 12:76031125-76031147 CAGCAGCAGCAACAACAGCCCGG - Exonic
1098985123 12:77003989-77004011 TGGCAGCAGCAGCCTCAGTGAGG + Intergenic
1099277628 12:80597830-80597852 CAGCAGCATCAACATCACTGGGG - Intronic
1099684998 12:85874074-85874096 AAGCAGCAGCAGCAGCAATTAGG + Intergenic
1099697870 12:86044359-86044381 CAGCAGCAGTGGCAGCATGGTGG + Intronic
1099878016 12:88433238-88433260 CAGCAGCAAGGTCAGCAGTGAGG - Intergenic
1100089630 12:90954375-90954397 GAGCAGCAGCAAAAGCAGAGAGG + Exonic
1100243456 12:92732963-92732985 CACGACCAGCAGCAGCAGCGGGG + Intronic
1100415543 12:94369884-94369906 AAGCAGCAGCAGCAGCAGCAAGG + Intronic
1101007436 12:100414903-100414925 CTGCAGCAGCAGCAGCTCTGGGG - Intronic
1101510590 12:105389291-105389313 CGGCAGCAGCAGCAACAGTGGGG - Intronic
1102347204 12:112167844-112167866 CAGCAGCAGCAGCGACAGCGAGG + Exonic
1102408411 12:112694508-112694530 CAGCAGCAGCAGCATAAGAAAGG + Intronic
1102487154 12:113266283-113266305 CAGCAGCAGCAGCAGGGCCGTGG - Exonic
1102491202 12:113290550-113290572 CAGCTGCAGCAGCAGTGGTGTGG - Intronic
1102833170 12:116026592-116026614 CAGCAGCAGCAGCATCACATGGG - Intronic
1102965029 12:117119130-117119152 CAGCAGCAGCAGCAGCTTGGAGG - Intergenic
1102997705 12:117362432-117362454 GAGCAGCAGCAACAGCAACGGGG - Intronic
1103005404 12:117416642-117416664 CAGCATCAGCATCAGCAGTCAGG + Intronic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103209548 12:119156573-119156595 CAGCAGCAGCAGTAGCCGCTCGG + Exonic
1103300963 12:119926424-119926446 TAGCAGCAGCAGCAGCACCCAGG + Intergenic
1103308952 12:119989476-119989498 CAGCGGCAGCGGCAACAGGGCGG + Intergenic
1103458542 12:121086138-121086160 CAGCAGCTGCCCCAGCAGTCTGG + Intergenic
1103635733 12:122303684-122303706 CAGAAGCAGTAGGAGCACTGTGG - Intronic
1103908678 12:124340172-124340194 GAGCAGCGGCAGCAGCGGCGGGG - Exonic
1103956855 12:124582220-124582242 CAGCAGCAGCAGCACCAGCCTGG - Intergenic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104642008 12:130473416-130473438 CAGGAGCAGCAGCAGCATCTGGG + Intronic
1104642011 12:130473419-130473441 GAGCAGCAGCAGCATCTGGGGGG + Intronic
1104741259 12:131176507-131176529 CACAAGCAGCAGCCCCAGTGGGG - Intergenic
1104759617 12:131289159-131289181 CAGCAACAGCAGCAGCCGATGGG + Intergenic
1104846840 12:131851201-131851223 CGGCAGCAGCAGCAGCATGGTGG - Exonic
1104857778 12:131909939-131909961 CAGGAGCAGCTGCCGCAGCGGGG - Exonic
1104958492 12:132477203-132477225 CAGCAGCTGCAGCAGGGCTGGGG - Intergenic
1104987619 12:132605884-132605906 CAGCACCAGGAGCAGCCCTGGGG - Intronic
1105306440 13:19172383-19172405 CAGCAGTGGCAGCAGCAGCAGGG - Intergenic
1105356361 13:19663471-19663493 CCGCAGCTGGAGCAGCAGGGAGG + Intronic
1105602588 13:21900500-21900522 CAGCAGCAGAAGCACCAGCCTGG + Intergenic
1106005308 13:25764538-25764560 AAGCAGCAGCGGCAGCAGCCGGG + Intronic
1106109287 13:26762187-26762209 CAGCAGCAGCAGCATCACTGGGG - Intergenic
1106250162 13:27976917-27976939 CAGCAGCAGCAACAGCAGCAAGG - Intergenic
1106478359 13:30117158-30117180 CAACAGCAGCAGCAGCACCTGGG + Intergenic
1106587491 13:31069985-31070007 CAGCAGCAGCAACAGAAGACAGG + Intergenic
1106701877 13:32237861-32237883 CAGCAGCAGCTGCTGCAGCCCGG - Exonic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107065728 13:36213041-36213063 CAGCAGCAGCTGCAGGGCTGAGG + Intronic
1107115320 13:36740373-36740395 CAGCAGAAGAAGCAGCGATGAGG - Intergenic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107404432 13:40099312-40099334 CAGCAGCAACAGCAGCAGTTTGG + Intergenic
1107702004 13:43058240-43058262 GAGCATCAGCTGCAGCAGTATGG + Intronic
1107826439 13:44332727-44332749 AGGCAGCAGCAGCAGCAGGGAGG - Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1108196157 13:47997559-47997581 CACTCCCAGCAGCAGCAGTGGGG - Intronic
1108478479 13:50843561-50843583 CAGCTGCTGCAGCAGGAGTGGGG - Exonic
1108639705 13:52371706-52371728 TAACAGCAGCAGCAGCAGGATGG + Intergenic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1108695639 13:52900201-52900223 CAGCAGCAGCAGCATCACCTGGG + Intergenic
1108884686 13:55165402-55165424 CACCAGCAGCAGCTGCATGGTGG - Intergenic
1108902997 13:55435899-55435921 TCACACCAGCAGCAGCAGTGGGG - Intergenic
1108912720 13:55577007-55577029 CAGCAGTGGCTGCAGCAGTGTGG - Intergenic
1109134135 13:58625711-58625733 TGGCAGCAGCAGCAGCAGGCAGG - Intergenic
1109495633 13:63168154-63168176 CAGCAGCAGCAGCAGCATCAGGG + Intergenic
1110094471 13:71499302-71499324 CACCTGCAGTATCAGCAGTGAGG - Intronic
1110273498 13:73617139-73617161 GGGCAGCAGCAGCTGCGGTGTGG - Intergenic
1110407156 13:75163234-75163256 GAGGAGAAGCAGCAGCAATGGGG + Intergenic
1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG + Intergenic
1110630146 13:77698077-77698099 CAGCAGCAGCAGGTGCGGGGCGG - Intronic
1110630147 13:77698080-77698102 CGGCAGCAGCAGCAGGTGCGGGG - Intronic
1111165035 13:84447536-84447558 CAGCTGCAGTGGTAGCAGTGGGG + Intergenic
1111888672 13:94054478-94054500 CAGCAGCATCAGCAGCACTTGGG - Intronic
1112200338 13:97268425-97268447 CAGCAGCAGCAGCATCCGCTGGG - Intronic
1112394464 13:99016032-99016054 CAGCAGCATCTGCAGCAGTGTGG - Intronic
1112504908 13:99969780-99969802 CAGCAGCAGCTGGAGCAGGAAGG - Intronic
1112558479 13:100491051-100491073 CAGCAGCAGCAGCAGCATTCAGG - Intronic
1112716079 13:102187584-102187606 GAGGAGAAGCAGCAGCAATGAGG - Intronic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1113445815 13:110365689-110365711 CAGCAGCAGGGGCTGCAATGGGG - Intronic
1113448380 13:110387798-110387820 GAGCAGCTGCAGCAGCTGGGCGG - Intronic
1113462461 13:110491707-110491729 AAGCAGCAGCAGCAACAGCGTGG - Intronic
1113491186 13:110693328-110693350 CAGCACCAGCAGCAGTAGGTGGG - Intronic
1113809568 13:113130100-113130122 CAGCAGAAGCACTAGCACTGAGG + Intronic
1113831271 13:113297463-113297485 CAACAGCAGTAGCAGCAGCAGGG - Exonic
1114261896 14:21043021-21043043 CAGCAGCAGAAGCAGCAGAAGGG - Exonic
1114407053 14:22466780-22466802 CAACAGCAGCACCTGCAGCGTGG + Intergenic
1114454416 14:22845924-22845946 CACCAGGAGCAGCAGCAGCACGG - Exonic
1114519007 14:23321483-23321505 CGGCGGCGGCAGCAGCAGCGGGG + Exonic
1114634640 14:24180541-24180563 CGTCAGGAGCAGCAACAGTGCGG + Exonic
1115028254 14:28766876-28766898 CAGCAGCAGCAGCAGCCCAAAGG - Intergenic
1115058561 14:29162304-29162326 CAGCAGCAGCACCAGCAGAAGGG - Intergenic
1115351149 14:32397147-32397169 CAGTAGCAACAGCACCATTGTGG - Intronic
1115531165 14:34328500-34328522 CAGCAGAAGGAGCAGCAGCTGGG + Intronic
1115923882 14:38409213-38409235 CAGAGGCAGCAGGATCAGTGTGG + Intergenic
1116484730 14:45433975-45433997 CGGCAGCAGCAGCAGCAGCAGGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1116861573 14:49999985-50000007 AAGCAGCAGCAGCAGCCAAGGGG + Intronic
1117512868 14:56471140-56471162 CAGCAGTGGCAGTAGCAGTGGGG + Intergenic
1117638825 14:57775300-57775322 CAGCAGTGGCAGCAGCAGTGTGG - Intronic
1117812850 14:59566936-59566958 CAGCAGCAGCATCACCTGTCAGG + Intronic
1117835587 14:59802274-59802296 CAGCAGCACCAGCATCAGCTGGG + Intronic
1118038797 14:61895662-61895684 CAGCAGCAGCATCAGTGGTGTGG - Intergenic
1118678292 14:68212431-68212453 CAACAGCAGCACCAGCAGCAAGG + Intronic
1118796172 14:69147368-69147390 CAGCAGCAGTAGCAACAGCATGG + Intronic
1118823234 14:69358504-69358526 CAGCAGGTGGAGCAGCAGAGTGG + Intergenic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119499841 14:75115725-75115747 CAGCAGCATCAGCATCACTTGGG + Intronic
1119573753 14:75699685-75699707 GAGAAGCAGCAGCAGTAGCGAGG - Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119634664 14:76264194-76264216 TGGCAGCAGGAGCAGCAGAGAGG + Intergenic
1120118053 14:80643267-80643289 CATCAGCAGTGGCACCAGTGAGG + Intronic
1120185876 14:81393417-81393439 CAGCAGCAGCAGGAAGAGTGAGG + Intronic
1120788834 14:88561219-88561241 CAGCAGAAGCAGGAGTTGTGGGG - Intergenic
1120834991 14:89031224-89031246 GAACAGCAGCAGGAGCACTGAGG + Intergenic
1121013616 14:90535450-90535472 CCAGAGCAGCAGCAGCAGGGAGG - Exonic
1121038360 14:90725334-90725356 CAACAGCAGCAGCAGCAGACAGG - Intronic
1121070340 14:91013742-91013764 GACCAGCAGCAGCAGCAGCGTGG + Intronic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121223852 14:92306949-92306971 CAGCAGCAGCAGCATCACCTAGG - Intergenic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121407604 14:93728478-93728500 AAACACCAGCAGGAGCAGTGGGG + Intronic
1121492956 14:94372848-94372870 CGGCAGAAGCAGCAGAGGTGAGG - Intergenic
1121563833 14:94894057-94894079 CAGCTGCAGCTGCAGCGGTATGG - Intergenic
1121711050 14:96039452-96039474 CAGCGGCAGCGGCAGCAGCGAGG + Exonic
1121874635 14:97440136-97440158 CAGCAGCAGCAGCAGTCATGTGG + Intergenic
1122185746 14:99993763-99993785 CAGAAGCAGAGGCTGCAGTGAGG - Intronic
1122500421 14:102194464-102194486 AAGCAGCAGCAGCAGCATGTGGG - Intronic
1122521728 14:102348854-102348876 CAGAATCAGCAACAGCACTGAGG + Intronic
1122636726 14:103133446-103133468 GAGCAGCAGCAGCAGCTGGCTGG + Exonic
1122723676 14:103736387-103736409 CGGCAGCAGGAGCAGCAGCTGGG - Intronic
1122738696 14:103858482-103858504 CAGCAGCATCAGCAGCACAGGGG - Intergenic
1122813656 14:104301626-104301648 CAGCGGTAACAGTAGCAGTGGGG - Intergenic
1122905028 14:104797657-104797679 CAGTCCCAGCAGCAGCCGTGGGG - Intergenic
1122918945 14:104871710-104871732 GAGCCGCAGCAGCAGGAGTTGGG + Intronic
1122975269 14:105168370-105168392 CAGCAGCAGCAGCAGCCGCCGGG + Exonic
1123168586 14:106349559-106349581 CAGCTGCAGCTGCAGGAGTCCGG - Intergenic
1123171154 14:106373931-106373953 CAGGTGCAGCTACAGCAGTGGGG - Intergenic
1123176272 14:106421985-106422007 CAGCTGCAGCTGCAGGAGTCGGG - Intergenic
1123222891 14:106873024-106873046 CAGGTGCAGCTGCAGGAGTGGGG - Intergenic
1123498053 15:20850180-20850202 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1123555284 15:21423808-21423830 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1123579430 15:21703251-21703273 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1123591529 15:21861139-21861161 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1123616057 15:22145762-22145784 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1123721375 15:23064553-23064575 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
1124004233 15:25783794-25783816 CAGCAGGAGAAGCAGCTCTGAGG - Intronic
1124179028 15:27456086-27456108 CTGCAGGACCAGAAGCAGTGCGG - Intronic
1124363364 15:29054604-29054626 CAGCATCACCAGCGCCAGTGAGG + Exonic
1124513974 15:30350589-30350611 GAGCAGGAGTGGCAGCAGTGGGG - Intergenic
1124588650 15:31034401-31034423 CAGCAGCACCTGCAGCAGATGGG - Intronic
1124728947 15:32180176-32180198 GAGCAGGAGTGGCAGCAGTGGGG + Intergenic
1124801621 15:32838493-32838515 CACAAACAGCAGCAGCCGTGGGG + Intronic
1124929124 15:34101789-34101811 TAGCAGCAGCAGCAGCAGGACGG + Exonic
1124962716 15:34410364-34410386 CAGCATCACCAGCACCAGTGAGG + Intronic
1124979342 15:34556586-34556608 CAGCATCACCAGCACCAGTGAGG + Intronic
1125241462 15:37582027-37582049 CAGCTGCAGCCGCAGCTGTGTGG - Intergenic
1125434326 15:39629017-39629039 CAGCAGCAGCAGCAGCCAGATGG + Intronic
1125522960 15:40358342-40358364 CAGCAGCGGCGGCAGCGGTCCGG + Exonic
1125536898 15:40446253-40446275 AAAGAGCACCAGCAGCAGTGAGG + Intronic
1125703624 15:41711188-41711210 CAGCAGCAGCAACAGCAACAGGG + Exonic
1125831383 15:42719211-42719233 AAGCAGCAGCCTCAGCAGAGCGG + Intronic
1125882160 15:43204324-43204346 CAGCAGCAGCAGCAGCATTTAGG - Intronic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1125965582 15:43873170-43873192 CAACAGCAGCATCAGGGGTGGGG - Exonic
1126506081 15:49406239-49406261 CAGCAGCAGCAATAGAAATGTGG + Intronic
1126580672 15:50239844-50239866 CAGCAGCATCAGCAGCACCTGGG + Intergenic
1126829561 15:52587067-52587089 CAGCAGCAGTAGCAGGAGAAAGG + Intronic
1126915557 15:53462235-53462257 CTGAGGCAGCAACAGCAGTGGGG - Intergenic
1127428580 15:58880435-58880457 CAGCAGCAGCAGCACCAGCTGGG + Intronic
1127474076 15:59315772-59315794 CAGCAACAGCAGCAGCATTGGGG - Intronic
1127837000 15:62797983-62798005 AAGCAGCAGCTGCTGCAGGGAGG + Intronic
1127846188 15:62873557-62873579 CAGCAGCAGCTGCTCCTGTGGGG + Intergenic
1127884506 15:63187839-63187861 CAGCAGCAGCAGCAGCCCTCTGG + Intergenic
1127903307 15:63357331-63357353 CAGCAGCAGCAGCATCACCTGGG - Intronic
1128153505 15:65377714-65377736 CAGCAGCGGCAGCAGGAGCCGGG + Exonic
1128203953 15:65833988-65834010 CTGCAGCAACAGCACCAGGGTGG - Intronic
1128338533 15:66803677-66803699 CAGCAGCATCAGCAGCACCTGGG + Intergenic
1128520780 15:68373357-68373379 CTGCAGCAGGAGCAACTGTGGGG + Intronic
1128554746 15:68623696-68623718 CAGGAGCAGCAGCAGCGGGTGGG + Intronic
1128684270 15:69672032-69672054 GAGGGGCAGCAGCAGGAGTGTGG + Intergenic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1129332278 15:74833798-74833820 GGGGAGCAGCAGCAGCACTGAGG + Intergenic
1129538952 15:76335996-76336018 CAGCAGCGGCAGCAGCAGCAAGG + Intergenic
1129564988 15:76612209-76612231 CAGCAGCAGCAGCAGCTTTTTGG - Intronic
1129607095 15:77030314-77030336 GAGCAGCAGCAGCACCAGCGTGG + Intronic
1129649014 15:77466682-77466704 CAGCAGCACATGCAGCATTGTGG - Intronic
1129679849 15:77652618-77652640 CAGCAGGAGCAACAGCTGAGAGG - Intronic
1129741558 15:77992063-77992085 CAGCGGCAGCAGCAGGAGCAAGG + Intronic
1129919912 15:79311275-79311297 CAGCAGCAGAAGCAGCACGGAGG - Exonic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1129977706 15:79836257-79836279 AAGCAGCAGCAGCAGCACCCAGG + Intronic
1130040946 15:80404693-80404715 CCGCAGCATCAGCACCAGAGCGG + Intronic
1130113914 15:80989723-80989745 CAGCAGCAGCAGCAGGTCAGAGG + Exonic
1130168964 15:81492322-81492344 CAGCAGCAGGAGCTGCTTTGGGG + Intergenic
1130844896 15:87735310-87735332 CAACAGCAGTAACAGCAGAGTGG - Intergenic
1130858212 15:87860986-87861008 CAGCAGCAACAACAACAGTGTGG - Intronic
1130881753 15:88061526-88061548 GAGCAGGAGCAGGAGCAGAGTGG + Intronic
1131032725 15:89199958-89199980 CCGAGGCAGCAGCAGCAGAGGGG - Exonic
1131139347 15:89964439-89964461 CAGCAGCAGCAGGATCAGTCAGG - Intergenic
1131466054 15:92655615-92655637 CAGCAGCAGCGGCAGGAGCGGGG + Exonic
1131466055 15:92655618-92655640 CAGCAGCGGCAGGAGCGGGGCGG + Exonic
1131845630 15:96487868-96487890 AAGCAGCAGCAGCTGCCTTGAGG - Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1131902241 15:97100379-97100401 CAGCAACAGTAGCAGCACTTTGG - Intergenic
1132026094 15:98405537-98405559 GAGCAGCAGCAACAGCAGCCTGG - Intergenic
1132087576 15:98920990-98921012 GCGCGGCAGCAGCAGCAGAGAGG - Intronic
1132199737 15:99943275-99943297 CACGAGCAGCTGCAGCAGCGTGG + Intergenic
1202963630 15_KI270727v1_random:151017-151039 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1202988300 15_KI270727v1_random:437496-437518 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1132550831 16:553245-553267 CAGGGGCAGGAGCAGGAGTGGGG - Intronic
1132590994 16:726422-726444 CAGTGGCAGCAGCAGCCATGGGG - Exonic
1132645497 16:997529-997551 CAGCGGCAGGAGCGGCAGGGAGG + Intergenic
1132681309 16:1143190-1143212 TAGCAGCAGCAGTGGCAGTGAGG - Intergenic
1132712744 16:1276712-1276734 CAGCAGCAGCAGCAGCTGCGGGG + Intergenic
1132845723 16:2000003-2000025 CAGCAGCAGTAGCAGCAAGAAGG - Exonic
1132953078 16:2575729-2575751 GAACAGCAGCAGCAGCAGCGAGG + Intronic
1132961273 16:2624439-2624461 GAACAGCAGCAGCAGCAGCGAGG - Intergenic
1133129212 16:3665842-3665864 TGGCAGCAGCAGCAGCAGCCAGG + Intronic
1133138458 16:3728397-3728419 CAGCAACAGCAGCAGCAGCAAGG - Exonic
1133288281 16:4701487-4701509 CCAGAGCAGCAGCAGCAGCGAGG - Exonic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1133337832 16:5017649-5017671 CAGAAGCCGCAGCAGGATTGGGG + Exonic
1133456839 16:5949729-5949751 CAGCAGCAGCAGCATCAACTAGG + Intergenic
1133481556 16:6175721-6175743 CAGCAGCAGCGGCACCAATGGGG - Intronic
1133598190 16:7313043-7313065 CAGAAGGAAGAGCAGCAGTGGGG - Intronic
1133663897 16:7946365-7946387 CAGCAGCGTTGGCAGCAGTGTGG + Intergenic
1133755337 16:8758429-8758451 CAGCGGCAAGGGCAGCAGTGTGG + Intronic
1133784313 16:8963248-8963270 CAGCAGCAGCAGCAGAAAGCGGG - Exonic
1133801927 16:9091702-9091724 CAGCGGCGGCGGCGGCAGTGGGG + Exonic
1133845491 16:9449667-9449689 CAGTAGCTGCAGCAGCAGCAGGG + Intergenic
1133907524 16:10035657-10035679 CAGCAGCATCAGCATCACTTGGG - Intronic
1134143590 16:11742685-11742707 CGGCGGCAGCAGCAGCAGCGAGG - Exonic
1134592209 16:15463738-15463760 CAGCAGCAGGAGCTGGGGTGGGG - Intronic
1134633843 16:15777444-15777466 CAGCAGCATCAGCATCACTTGGG - Intronic
1134668337 16:16036374-16036396 GAGCAGCATCAGCAGGCGTGTGG + Intronic
1134761522 16:16718951-16718973 CAGCAGCATCAGCACCAGCCTGG + Intergenic
1134762321 16:16725155-16725177 AAGCAACAGCAGCAGCAGGATGG + Intergenic
1134769218 16:16791534-16791556 AAGCAGCAGAAACAGCAATGTGG + Intergenic
1134983738 16:18634015-18634037 AAGCAACAGCAGCAGCAGGATGG - Intergenic
1134984536 16:18640219-18640241 CAGCAGCATCAGCACCAGCCTGG - Intergenic
1135091525 16:19521899-19521921 CAGCAGCACTAGCAGCAGGAAGG + Exonic
1135189272 16:20341592-20341614 CAGCAGCATCAGCAGCATCCAGG - Intronic
1135839432 16:25861197-25861219 CAGTCACAGCAGAAGCAGTGAGG + Intronic
1135983929 16:27169680-27169702 CAGCAGCCGCTGCAGAAGTTAGG + Intergenic
1136019337 16:27430091-27430113 GAGCAGCAGCAGGAGCAAGGGGG - Exonic
1136027915 16:27481809-27481831 CAGCTGGGGCAGCAACAGTGAGG - Intronic
1136080455 16:27849123-27849145 AAGCTGCAGAAGCTGCAGTGAGG + Intronic
1136269418 16:29139680-29139702 CCGCAGCAGCAGCAGCACGTTGG - Intergenic
1136368351 16:29820335-29820357 CAGCTGCAGCAGAAGCAGCCCGG + Exonic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136406468 16:30050793-30050815 CAGGAGCAGCAGCTGTGGTGAGG + Intronic
1136459867 16:30403261-30403283 CAGCAGCAGCAGCAGCTTGTGGG - Intergenic
1136550464 16:30979920-30979942 CAGCAGCAGCAGCAGCGATGGGG + Exonic
1136622153 16:31436398-31436420 CCGCAGCTGCAGCAGCAGAAGGG + Exonic
1136858768 16:33681986-33682008 CAGGGGCCACAGCAGCAGTGAGG + Intergenic
1137334452 16:47533877-47533899 CAGCTGCAGCTGCACCAGGGAGG + Intronic
1137343760 16:47636316-47636338 CAGCTGCAGCAGGGGAAGTGTGG + Intronic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1137673936 16:50294569-50294591 CAGCAGCAGCAGGAGCACGCAGG - Intronic
1137723686 16:50642680-50642702 CAGCAACAGTAGCTGCAGTTAGG + Intergenic
1137775014 16:51047213-51047235 CAGAAGCAGCAGCAGCAGCTGGG + Intergenic
1137783339 16:51115972-51115994 CAGGAGCAGCAGCAGCATACTGG - Intergenic
1137810672 16:51349859-51349881 CAGCAGCAGCCGCCGCCATGAGG + Intergenic
1138112599 16:54336860-54336882 CAGCAGCTGCCACAGCAGTAAGG + Intergenic
1138166654 16:54808118-54808140 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
1138356312 16:56383797-56383819 AAGCAGCAGGACCAGCAGTTAGG - Intronic
1138382048 16:56609256-56609278 CAGCAGGAGCAGCAGCCTGGGGG - Exonic
1138383335 16:56618582-56618604 CAGCAGGAGCAGCAGCCTGGGGG - Intergenic
1138387355 16:56644706-56644728 GGGCAGCAGGAGCAGCAGTCTGG - Intronic
1138461587 16:57151546-57151568 GAGGAGCAGCAGAAACAGTGGGG + Intergenic
1139099189 16:63744640-63744662 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139249707 16:65482998-65483020 CAGCAGGACGAGCAGCACTGTGG + Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139447462 16:67006669-67006691 CAGAAGCAGCAGGAGTAGGGTGG + Intronic
1139459410 16:67109967-67109989 CTGCAGCAGCCGCGGCAGCGGGG - Exonic
1139662129 16:68428446-68428468 GAGCAGGAGCAGCAGCAGAAGGG + Intronic
1139734138 16:68972884-68972906 GAGCAGCAGCAGATGCAGAGGGG + Intronic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1140550157 16:75856603-75856625 CAGCAGGAGCAGGATCTGTGTGG - Intergenic
1140619842 16:76716708-76716730 CAGCATCAGCTATAGCAGTGTGG - Intergenic
1140820795 16:78661243-78661265 CTCCAGCAGCAGCAACAGAGAGG + Intronic
1140851162 16:78935932-78935954 AAGCAGCAGCAGCAGCAGCTAGG + Intronic
1140894226 16:79310991-79311013 AAGCAGCCGCAGCAGCAGCCAGG - Intergenic
1140954543 16:79849806-79849828 CAGCAGCTGTAGGAGGAGTGGGG - Intergenic
1141062999 16:80892244-80892266 CAGCAGCAGCAGCCGCACCTGGG + Intergenic
1141071138 16:80955324-80955346 CAGCAGCAGCAGCAGCGTAGTGG - Intergenic
1141128311 16:81416953-81416975 CGGCAGCAGCAGCAGCAGCTAGG + Intergenic
1141278933 16:82613269-82613291 CAGGAGAAGCAGCAGAAATGAGG - Intergenic
1141622999 16:85247055-85247077 GAGCAGCAGCAGCAGCCCTGGGG - Intergenic
1141859061 16:86704227-86704249 CAACAGCGGAAGCAGCAGGGCGG + Intergenic
1141894208 16:86948170-86948192 GAGCAGGAGCAGGAGCAGAGTGG - Intergenic
1141915499 16:87093896-87093918 CAGCCGCAGCAGCCGCAGGGAGG + Intronic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1142023217 16:87797169-87797191 CAGCAGCATCAGGAGCACTGTGG + Intergenic
1142126624 16:88413810-88413832 CTGCAGCCTCCGCAGCAGTGGGG + Intergenic
1142307855 16:89295541-89295563 CAGCAGCACCAGCACCAGGAAGG - Intronic
1142676797 17:1518460-1518482 CAGCAGCAACACCATCCGTGGGG + Exonic
1142707538 17:1705907-1705929 ACGCAGCAGAAGCAGCAGGGAGG + Exonic
1142879519 17:2873510-2873532 AAGCAGCAGCAGCTGCAGAAAGG + Intronic
1143027950 17:3951974-3951996 GACCAGCAGCAGCAGCAGCTGGG + Intronic
1143147538 17:4786311-4786333 CAGCAGCAGCGGCAGCAGCTTGG + Exonic
1143550953 17:7630198-7630220 CAGCAACAGCAGCAGGCGCGAGG - Exonic
1143585514 17:7848511-7848533 CAGCAGGAGCAGTAGTGGTGGGG - Exonic
1143784772 17:9248045-9248067 GAGGAGCAGGGGCAGCAGTGAGG - Intergenic
1143946002 17:10592620-10592642 CAGCAGCATCAGCACCAGCTGGG + Intergenic
1144006932 17:11109280-11109302 CAGCAGCAGCAGCATAACTTGGG + Intergenic
1144114766 17:12077298-12077320 CTCCAGCATCAGCAGCAGTTTGG - Intronic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144273637 17:13643900-13643922 CAGCAGCATCAGCCTCACTGGGG + Intergenic
1144630701 17:16870756-16870778 CATCAGCAGCAGCAGCCCCGGGG + Intergenic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1144650616 17:17004693-17004715 CATCAGCAGCAGCAGCCCAGGGG - Intergenic
1144701998 17:17346291-17346313 CATCACCAGCAGCACCAGTGTGG + Intronic
1144733404 17:17541472-17541494 CACCGGCCGCAGCAGCAGCGGGG + Intronic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1145276998 17:21437505-21437527 CAGCAGCAGGAGCAGGGTTGAGG - Intergenic
1145314829 17:21723404-21723426 CAGAGGCGGCAGCAGGAGTGGGG - Intergenic
1145415996 17:22714589-22714611 TAGCAGCATCAACACCAGTGAGG + Intergenic
1145764902 17:27451893-27451915 CAGGAGCAGCAGCAACTGTATGG - Intergenic
1146439797 17:32883899-32883921 CAGCAGCATCAGCATCACTTGGG - Intergenic
1147132133 17:38415736-38415758 GAGCAGCAGGTGCAGGAGTGGGG + Intergenic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147262789 17:39218271-39218293 CAGCAGCAGCAGCAGCGTGGGGG + Intronic
1147374468 17:40015685-40015707 CAGCAGCAGCTGCAGGGCTGGGG - Exonic
1147475117 17:40703531-40703553 CAGCAGCTGCAGCCTGAGTGGGG - Exonic
1147507103 17:41029729-41029751 CAGCAGTGGCAGCAGCAGGCTGG + Exonic
1147507499 17:41034334-41034356 CAGGAGTAGCAGCAGCAGACTGG + Exonic
1147508134 17:41040880-41040902 GAGCAGTAGCAGCAGCAGACTGG + Exonic
1147696502 17:42358844-42358866 CACCAGCAGCACCAGCACAGAGG - Intronic
1147923429 17:43932579-43932601 CGGCAGCAGAAGCAGCTCTGCGG + Intergenic
1147964788 17:44188715-44188737 CAACAGTAGCAGCAGCAGCAAGG + Intronic
1148021692 17:44557711-44557733 CAGCAGCGGCAGCAGCAGGCGGG - Exonic
1148070441 17:44905701-44905723 CAGCAGCAGCAGCAGGTGGCAGG + Intronic
1148105107 17:45114798-45114820 CAGCAGCTGCTGCAACACTGGGG - Intronic
1148218308 17:45845859-45845881 CAGCAGAGGCAGCGGCAGAGAGG - Exonic
1148647168 17:49225714-49225736 GGGCAGCAGGAGAAGCAGTGGGG + Intronic
1148768845 17:50055736-50055758 CAGCAGCAGCCGCAGGAAAGCGG + Intergenic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149092542 17:52801464-52801486 CAGCAGTAGCAGTAGCAGATTGG - Intergenic
1149328873 17:55561100-55561122 CAGCAGCAGCGTCTGCAGGGAGG - Intergenic
1149599707 17:57885522-57885544 GAGCAGCAGCGGCAGCGGCGGGG - Exonic
1149634694 17:58157219-58157241 CAGCAGCAGTAGCCGCAGGGTGG - Intergenic
1149771897 17:59329082-59329104 CAGCAGCAGTAGCACCAATATGG + Intergenic
1150228241 17:63535290-63535312 CAGCATGAGCAGCGGCACTGAGG - Intronic
1150311086 17:64130000-64130022 CAGCAGCAGCAGCAGCCGCCGGG + Exonic
1150318310 17:64188335-64188357 CAGCAGCAGCAAAGGCAGTGTGG - Exonic
1150484123 17:65532421-65532443 AAGCAGCAGCAGCAGCAGCCAGG + Intronic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151285753 17:73109842-73109864 CAGCAGCAGCAGCGACAGAAAGG + Intergenic
1151325364 17:73376709-73376731 GGGCAGCGCCAGCAGCAGTGTGG - Intronic
1151437001 17:74103998-74104020 CAGCAGCATCAGTATCACTGGGG - Intergenic
1151557295 17:74852836-74852858 CCGCAGCATCAGCACCACTGGGG + Intronic
1151637913 17:75365173-75365195 CAGCAGATGGAGCTGCAGTGGGG - Intronic
1152068639 17:78124614-78124636 CACCAGCAGCAGCAGCAGGAGGG + Exonic
1152072476 17:78140750-78140772 CAGCAGCGGCAGCAACTCTGCGG - Intronic
1152256334 17:79242182-79242204 CACCAGCAGCAGCAGCACGCTGG - Intronic
1152371173 17:79889447-79889469 TAGCAGCAGTAGCAGCAATGGGG - Intergenic
1152415828 17:80161167-80161189 GAGGAGCAGCAGCAGCAGCAGGG + Intergenic
1152540052 17:80970287-80970309 CCGCCGCAACAGCTGCAGTGAGG - Intergenic
1152588530 17:81199816-81199838 CAGGAGCAGCGGCAGCGGTCAGG - Exonic
1152651377 17:81495056-81495078 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1152676634 17:81644778-81644800 GAGCAGCAGAAGGGGCAGTGAGG - Intronic
1152681868 17:81672633-81672655 CAGCGGCAGCAGCAGCTGCACGG + Exonic
1152698804 17:81809044-81809066 CAGCAGCAGCAACAGCAGCAGGG - Exonic
1152748429 17:82051686-82051708 CAGCGGCAGTAACAGCAGCGCGG + Exonic
1152809487 17:82374842-82374864 CAGCAGCAGCGCCAGCAGCCAGG - Exonic
1153013792 18:565276-565298 CAGCAGCAGCAGCAGTGGGATGG - Intergenic
1153104368 18:1510576-1510598 CAGTAGTGGCAGCAGCAGTCAGG + Intergenic
1153766091 18:8376400-8376422 AAAAAGCAGCAGCAGCAGTGTGG + Intronic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1154121186 18:11653921-11653943 GAGCAGCATCAGCTGCTGTGTGG - Intergenic
1154184947 18:12174982-12175004 CAGCAGTAGCAGCAGCATAGTGG + Intergenic
1154219517 18:12440100-12440122 CAGGTGCAGCAGCTGCAGTGAGG - Intergenic
1154456054 18:14526609-14526631 CAGCAGCAAGAGCAGGAGCGAGG + Intronic
1154979346 18:21489715-21489737 CACCAGCAGCAGCAGCACCTGGG - Intronic
1155248026 18:23929180-23929202 CAGCAGCAGCAGCAGCTAGTTGG + Intronic
1155627345 18:27849851-27849873 CAGCAGCAGCAGCACCTCTCAGG - Intergenic
1155708603 18:28847529-28847551 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
1155779388 18:29811786-29811808 CAGCAGCAGCAGTAGCACAGTGG - Intergenic
1156112676 18:33746281-33746303 CAGCAACAACAGCAGCTCTGTGG + Exonic
1156294067 18:35774106-35774128 CAGAAGCTGCAGCAGCAGAGGGG - Intergenic
1156367179 18:36440161-36440183 CAGCAGCATCAGCATCACTTGGG - Intronic
1156637861 18:39052640-39052662 CAGCAGCAGCAGCAGAAATTGGG + Intergenic
1156666814 18:39418594-39418616 AAGAAGCAGCAGCAGCAGCAAGG + Intergenic
1156791198 18:40976602-40976624 TGGCAACAGCAGCAGCTGTGGGG + Intergenic
1156893443 18:42216016-42216038 CAGCAGCAGGATGAGCTGTGTGG - Intergenic
1157113094 18:44839398-44839420 CAGCAGCAGCAGCAACACCCAGG - Intronic
1157450338 18:47781802-47781824 CACTAGCAGCAGGAGCAGTTGGG - Intergenic
1157565061 18:48674337-48674359 CAGGAGCTGCAGCAGCACAGGGG - Intronic
1157610075 18:48950534-48950556 CAGCAGCAGCAGCAGGGGCCCGG + Exonic
1157740963 18:50092431-50092453 ACGCAGCAGCAGCAGCAGGATGG - Intronic
1157788388 18:50507324-50507346 GCCCAGCAGCAGCTGCAGTGGGG - Intergenic
1157981101 18:52381487-52381509 CAGGAGCAGGAGCAACATTGAGG + Intronic
1158568829 18:58579401-58579423 CAGCAGCCTCGGGAGCAGTGGGG + Exonic
1158578585 18:58661523-58661545 AAGCAGCAGCAGCAGCTGGTAGG + Intergenic
1158727423 18:59986312-59986334 CAGAAGCTGGAGCAGCTGTGAGG - Intergenic
1158758032 18:60349940-60349962 CAGCAGCAGCCGCAGCCTTCTGG - Intergenic
1159002587 18:62987396-62987418 CTGCAGCAGAGGCAGCTGTGAGG - Intergenic
1159039365 18:63309199-63309221 CAGCATCAGCAGTAGCATTTAGG + Intronic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159367239 18:67484147-67484169 CAGCAGCGGATGCAGCACTGAGG - Intergenic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1160047380 18:75399719-75399741 CAGCAGCAGCAGCAGCAAAAGGG - Intergenic
1160057681 18:75499998-75500020 CAGCAGCAGCAGCAGCATCCAGG + Intergenic
1160377369 18:78423185-78423207 CAGCAGCAGCAATAGCAGGGGGG - Intergenic
1160796025 19:945792-945814 CAGCACCAGCAGCAGGAGCCGGG - Intronic
1160818448 19:1046999-1047021 GAGCACCAGAACCAGCAGTGCGG - Exonic
1160865096 19:1252847-1252869 CAGCAGCAGCAGCAGTGGCGTGG + Intronic
1160866178 19:1257143-1257165 CAGCGACAGCAGTAGCAGCGGGG + Exonic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161645803 19:5452671-5452693 CAGCATCAGCACCTGCACTGCGG - Intergenic
1161708265 19:5832493-5832515 CAGCAGCTGAAACAGCAGCGTGG + Exonic
1161710490 19:5844765-5844787 CAGCAGCTGAAATAGCAGTGCGG + Exonic
1161732872 19:5972794-5972816 GAGCAGAAGCAGCAGGAATGGGG - Intronic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1162870160 19:13580438-13580460 CAGCAGCAGCAGCATCACCTAGG + Intronic
1162907035 19:13830287-13830309 CAGCTGCAGTCGCAGCAGAGTGG - Exonic
1163158753 19:15452694-15452716 GAGCAGCAGGAGCAGCTGCGGGG - Exonic
1163175939 19:15564122-15564144 CAGCAGCAGGAGCAGCCATGGGG - Intergenic
1163186259 19:15641465-15641487 CAGCAGCAGGAGCAGCCACGGGG - Exonic
1163190528 19:15673579-15673601 CAGCAGCAGGAGTAGCCATGGGG - Exonic
1163222824 19:15934337-15934359 CAGCAGCAGAAGCAGCCACGGGG + Exonic
1163265249 19:16217006-16217028 CAGCAGCAGTAGTGGCAGTATGG + Intronic
1163385144 19:16995344-16995366 CAATTGCAGCAGCAGGAGTGGGG - Intronic
1163387429 19:17008388-17008410 CTCCAGCTGGAGCAGCAGTGGGG + Intronic
1163612769 19:18309704-18309726 CAGCAGCAGAAGCAGCAGAAAGG - Exonic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1163700114 19:18782667-18782689 CAGCAGCAGCTGCAGCACTGAGG + Intergenic
1163741624 19:19017472-19017494 CAGCCTCAGCTGCAGCACTGAGG - Intronic
1164161431 19:22627828-22627850 CAGCAGCAGCAGCAGCTTGGAGG + Intergenic
1164386571 19:27776133-27776155 CAGCAGCAGCAGTACCATTCAGG + Intergenic
1164711662 19:30361282-30361304 CAGCAGCAGTAGCAGCATCAAGG - Intronic
1164711779 19:30362011-30362033 TAGGACCAGCAGCAGCAGTGAGG - Intronic
1164976064 19:32573629-32573651 GCACAGCAGCAGCAGCAGAGGGG - Intergenic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165145357 19:33726874-33726896 GAGCAGGAGCAGCTGCACTGAGG - Intronic
1165309736 19:35022880-35022902 ATCCTGCAGCAGCAGCAGTGAGG - Exonic
1165331806 19:35144414-35144436 CAGAAGCAGGATTAGCAGTGGGG - Intronic
1165357853 19:35314928-35314950 CAGCAGCATCAGCAGCACCCAGG + Intergenic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1165452258 19:35890416-35890438 CAGCAGCAGCTGAACCAGAGTGG + Exonic
1165861628 19:38912117-38912139 CCGCAGCAGCAGCAGCTCAGAGG + Exonic
1165907808 19:39204228-39204250 CAGCAGCAGCGGGCGCAGCGGGG + Exonic
1165939640 19:39408573-39408595 CAGCAGCGGCAGCAGCCTGGGGG + Exonic
1166105737 19:40597266-40597288 CAGCAACAGCACCAGCAGGAGGG - Exonic
1166121647 19:40690533-40690555 CCACCGCAGCAGCAGCAGTCGGG - Exonic
1166218853 19:41353012-41353034 CAGCGGCAGCAGCCGCAGCCCGG + Exonic
1166364856 19:42273133-42273155 CGGCAGCCGCAGCAGCAGCGTGG + Intronic
1166385160 19:42376579-42376601 AGGCAGCTGGAGCAGCAGTGTGG - Exonic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1166871575 19:45873982-45874004 TAGCAGCCCCCGCAGCAGTGGGG + Intergenic
1167034030 19:46982715-46982737 CAGCAGCAGCAGCATCATCTGGG + Intronic
1167240928 19:48342560-48342582 GAAGAGCAGCAGCAGCAGGGAGG + Exonic
1167251004 19:48398430-48398452 CAGCAGCAGCAGCATCTTAGCGG - Exonic
1167285900 19:48598901-48598923 CTGCAGTAGCAGAGGCAGTGAGG + Intronic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167435362 19:49475692-49475714 CAGCAGCAGCAGGAGGAGATAGG - Exonic
1167436226 19:49480367-49480389 CAGCAGTAGGAGGAGCAGAGGGG - Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167498964 19:49835154-49835176 AAGCTGGAGCAGCAGCAGCGAGG + Exonic
1167581311 19:50344708-50344730 CAGAGGCAGCAGCAGCAGCAAGG + Intronic
1167584424 19:50365574-50365596 CAGAGGCAGCAGCAGCAGCAGGG + Exonic
1167617215 19:50541932-50541954 TAGCAGCAACAGCAGCAGAGTGG + Intronic
1167621709 19:50564413-50564435 CAGGAACAGCAGCAGAGGTGAGG + Intronic
1167713227 19:51124967-51124989 CAGCAGCAGCAGCATGTCTGGGG - Exonic
1167715818 19:51142362-51142384 CAGCAGCAGCAGCATATCTGGGG - Exonic
1167719225 19:51167394-51167416 CAGCAGCGGCAGCATCTCTGAGG - Intergenic
1167721802 19:51184805-51184827 CAGCAGCAGCAGCATGTCTGGGG - Intergenic
1167785216 19:51630306-51630328 CAGCAGGGGCAGCAGCAGCAGGG + Intronic
1167787315 19:51646730-51646752 CAGCAGGGGCAGCAGCAGCAGGG + Exonic
1168246994 19:55117455-55117477 CGGGAGCAGCTGCGGCAGTGGGG - Exonic
1168571415 19:57474157-57474179 CAGCACCAGAAGCAGCACAGTGG - Exonic
1168573994 19:57492933-57492955 CAACACCAGAAGCAGCACTGTGG + Exonic
1168575652 19:57506435-57506457 CAACACCAGAAGCAGCACTGTGG + Exonic
1168712892 19:58511911-58511933 GAGCAGCAGCAGCAGCAGCAAGG + Exonic
925339491 2:3126297-3126319 AAGAGGCAGCAGGAGCAGTGTGG - Intergenic
925354389 2:3227770-3227792 CAGCTGGAGCAGCAGCAGCTGGG - Intronic
925366406 2:3314960-3314982 CAGCAGCAGAAGATGCTGTGTGG - Intronic
925470290 2:4153713-4153735 AAACAGCAGCAGCAGCAGCCTGG - Intergenic
925568026 2:5277717-5277739 TAGCAGCAGGAGCAGCAGCAGGG + Intergenic
925609914 2:5693768-5693790 CAGCAGCGGCAGCAGCGGCGAGG + Exonic
925733714 2:6942483-6942505 TAGCAGTAGCAGCAGCAGCAGGG + Intronic
926021422 2:9499054-9499076 CAGCAGCAGCAGCATCACCTGGG - Intronic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926192088 2:10735969-10735991 CAGCAACACCAGCATCACTGGGG - Intronic
926623539 2:15070382-15070404 CAGCAGGGGCAGGAGCTGTGGGG - Intergenic
926689911 2:15725974-15725996 CAGCAGCACCAGCAGTGGAGAGG - Intronic
926756356 2:16239570-16239592 CAGCAGCAGCAGCAGAATGAAGG + Intergenic
927043688 2:19255656-19255678 GAGCAGCAGCAGCAGGATTGTGG + Intergenic
927181001 2:20446850-20446872 CCGCAGCGGCAGCAGCAGCGCGG + Intergenic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927319746 2:21729335-21729357 CAACAGTTGCAGCAGCTGTGAGG - Intergenic
927400342 2:22703697-22703719 CAGCAGCAGCAGTGGCAGTGGGG - Intergenic
927638457 2:24832233-24832255 CAGCAGCTGCAGCTGGAGAGTGG - Intronic
927937119 2:27082366-27082388 TGGCGGCAGCAGCAGCAGTGGGG + Exonic
928097269 2:28412379-28412401 CCGCAGAAGCAGTAGCAGCGGGG + Exonic
928164032 2:28956532-28956554 CAGCAGCAGCAGCATCACGTGGG - Intergenic
928278819 2:29926072-29926094 CAGGAGCAGCAGCAGCAAGCAGG + Intergenic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
928437940 2:31267935-31267957 CAACAGCACCAGCAGGAGAGTGG + Exonic
928490608 2:31778799-31778821 TAGCAGCTGCAGCTGCAGTGTGG - Intergenic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
928865616 2:35914307-35914329 CAGCAGCAGCAGTAGCAAGAGGG - Intergenic
929005288 2:37387608-37387630 CTGCAGCAGCTGCAACACTGAGG + Intergenic
929026698 2:37611707-37611729 CAGCAGCATCAGCATCAGCTGGG + Intergenic
929261732 2:39873439-39873461 GAGCAGCAGCAGCGGCAGCAAGG - Intergenic
929462987 2:42118174-42118196 TAGCAGCATCAGCATCACTGGGG + Intergenic
929465863 2:42143202-42143224 CAGAAAAAGCAGCAGCAATGAGG - Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
929604364 2:43225376-43225398 CACCTGCAGCAGCAGCAGAAGGG - Exonic
929604396 2:43225533-43225555 CGGCAGCAGCTGCGGCAGCGCGG - Exonic
929607053 2:43241695-43241717 CAGCAGCTGCTGGAGCAGAGCGG + Intronic
929782547 2:44966319-44966341 CAACTGTAGCAGCAGCAGAGAGG + Intergenic
929871077 2:45759860-45759882 CACCTGCAACAGAAGCAGTGAGG - Intronic
930047574 2:47186647-47186669 CAGCAGCAGCAGCAAGTGTAAGG - Intergenic
930092583 2:47541987-47542009 CAGCAGCAGCAGCGGCAGCAGGG + Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930096430 2:47570258-47570280 CAGCAGCAGCAGGAGGGGCGCGG + Exonic
930209214 2:48617344-48617366 CAGCAGCATCAGCAGCATCTGGG - Intronic
930712730 2:54564399-54564421 AAGCAGACGAAGCAGCAGTGAGG - Intronic
930714315 2:54578449-54578471 CAGCAGCAGCAGCAGCTAACCGG - Intronic
930716104 2:54595561-54595583 GAGCAGCAGCACCAGCAGCATGG - Intronic
930721915 2:54646271-54646293 CAGCAGCAGCCTCAGCGCTGAGG + Exonic
931046811 2:58363076-58363098 CAGCAAAAGCAGCAGCAATTGGG - Intergenic
931355961 2:61537917-61537939 CAGCAGAAGCGGCAGGAGTAGGG + Exonic
931462260 2:62459260-62459282 CAGCAGCTGCAGCTGCAAAGAGG + Intergenic
931489093 2:62725288-62725310 CAGCAGCGGCTGTGGCAGTGTGG + Intronic
931500199 2:62856454-62856476 CACCAGCTGCTGCAGCAGAGTGG - Intronic
931569189 2:63650320-63650342 CAGCAGCATAAGCATCATTGGGG - Intronic
931706257 2:64948803-64948825 CAGCAGCATCAGCATCACTTGGG + Intergenic
931731147 2:65154479-65154501 CAGCAGCATCAGCATCACTTGGG + Intergenic
931762359 2:65430080-65430102 GAGTAGCAGTAGTAGCAGTGAGG - Intronic
931881394 2:66574868-66574890 CAGCCGCAGCAGCAGCAGCAGGG + Intergenic
931889971 2:66661351-66661373 CAGCAGCTGCAGTGGCAGTGAGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932083751 2:68739092-68739114 CTTCTGCAGCAGCAGCAGAGTGG + Intronic
932455374 2:71846239-71846261 CCACAGCATCAGCAGGAGTGAGG + Intergenic
932593710 2:73081500-73081522 CGGCAGCAGTGGCAGCAGCGGGG + Intronic
932752169 2:74378218-74378240 CAGCGGCAGCAGGATGAGTGCGG - Exonic
933336321 2:80964195-80964217 TAGCAGCAGCAGCAGCAGCATGG + Intergenic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
933555178 2:83823074-83823096 AAGCAGCTACAGCAACAGTGTGG + Intergenic
933748099 2:85585222-85585244 CAGGATCTGCAGCAGGAGTGGGG - Intronic
933764487 2:85697483-85697505 CTGCAGCAGCAGCACCACAGTGG - Intronic
933881450 2:86673967-86673989 CAGCAGCACCAGCAGCACCTGGG - Intronic
934606047 2:95696089-95696111 CAGACGCAGCAGCAGGACTGGGG - Intergenic
934694801 2:96391869-96391891 CAGAAGCAGCAGGAAAAGTGGGG + Intergenic
934715648 2:96541871-96541893 CAGCAGCAGCAGCAGCTATCAGG + Intronic
934770425 2:96904199-96904221 CAGCAGCAGCAACAGCACAGTGG + Intronic
934860971 2:97763379-97763401 CACCAGTACCAGCAGCACTGGGG - Intronic
934943344 2:98518492-98518514 GCCCAGCAGCAGCAGCATTGTGG + Intronic
935304316 2:101721968-101721990 CATCAGCTGCAGCAGGAGTTAGG - Intronic
935570737 2:104658485-104658507 CAGCAGCAACAGGCACAGTGGGG + Intergenic
935666275 2:105515850-105515872 GAGCAGGAACAGCAGCAGGGTGG + Intergenic
935834671 2:107037365-107037387 CAGCAGATGCAGTAGCAGAGAGG - Intergenic
935848116 2:107188213-107188235 CAGCAGCAGCAGTAACAGCACGG - Intergenic
935852816 2:107241726-107241748 GAGCAGCAGCAGCAGCAGACAGG + Intergenic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
936712065 2:115142886-115142908 CACCACCAGCAGCAGCAGCAAGG - Intronic
936743494 2:115544789-115544811 CACCACCACCAGCAGCAGTGAGG - Intronic
936781624 2:116039827-116039849 CAGCAGCAGCAGCAGCATCTGGG - Intergenic
936901029 2:117482024-117482046 CACAAGCAGCAGCCTCAGTGGGG + Intergenic
936906006 2:117536398-117536420 AAGCAGGAGCAGCAGCAGCAAGG + Intergenic
936919801 2:117676263-117676285 GAGCAGAAGCAAGAGCAGTGGGG + Intergenic
937022525 2:118671364-118671386 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937303023 2:120854860-120854882 CAGCAGCAGCAGCAGCATCTGGG - Intronic
937318108 2:120944868-120944890 CAGCAGCAGCAGCATCCCTGTGG + Intronic
937343200 2:121104980-121105002 CAGCAGGAGGAGCAGCAGGCCGG + Intergenic
937355308 2:121194744-121194766 TAGGAGCAGCCACAGCAGTGAGG + Intergenic
937357764 2:121209023-121209045 CAGCAGCAGGGCCAGCAGAGGGG + Intergenic
937630165 2:124092365-124092387 CAGCAGCAACAACAGTAATGGGG - Intronic
937992771 2:127673683-127673705 CAGCCCCAGCAGCAGCATTGAGG - Intronic
938038048 2:128053029-128053051 AAGCATCAGCTGTAGCAGTGTGG + Intergenic
938163625 2:129008190-129008212 CAGCAGGAGCAGGAGCATGGTGG - Intergenic
938168823 2:129057039-129057061 AAGCAGCAGCAGCATCTGAGAGG - Intergenic
938243640 2:129761473-129761495 CTGCAGCAGCTGCTGCACTGTGG - Intergenic
938257132 2:129868264-129868286 CAGGAGCAGCAGCAGGACAGAGG + Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
938483743 2:131682512-131682534 CCCCTGCAGCAGCAGCAGCGTGG + Intergenic
938566846 2:132526317-132526339 CTGTAGAAGCTGCAGCAGTGAGG + Intronic
938693686 2:133815742-133815764 CAGCAGCAGTGGCAGCAGCAGGG - Intergenic
938784233 2:134610500-134610522 CATCAGCAGCAGCATCACTTGGG - Intronic
939089108 2:137757898-137757920 CAGCAGCAGTGGCAGCATGGTGG - Intergenic
939244934 2:139610726-139610748 CCCCAGCAGCAGCAGCAGTGTGG - Intergenic
939494819 2:142915367-142915389 AATAAGAAGCAGCAGCAGTGAGG + Intronic
939643626 2:144670077-144670099 CAGCAGAAAGAGCAACAGTGTGG - Intergenic
939696533 2:145332358-145332380 TAGCAGCAGGACTAGCAGTGGGG + Intergenic
939907980 2:147941916-147941938 CCTCAGCAGAAGCAGCAATGAGG + Intronic
939986343 2:148833153-148833175 CAGCAGCACCAGCAGCACCTGGG - Intergenic
939991064 2:148876640-148876662 CAGCAGCCCCAGCTGCAGAGAGG - Intronic
940031023 2:149261418-149261440 CAGCAGCAACAGCAGTAGTTTGG + Intergenic
940531708 2:154886335-154886357 CAGCAGCTGCAGTAGCACAGTGG + Intergenic
940962208 2:159798157-159798179 CAGCAACGGCAGCAGGAGCGCGG + Exonic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941291042 2:163675426-163675448 CAGCAGCAACAGCATCACTGGGG + Intronic
941389571 2:164894990-164895012 CAGCAGCAGCAGCATCACCTGGG + Intergenic
941806542 2:169716386-169716408 CATCAGCAGCTGCAGCTGTGTGG - Intronic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
941998323 2:171622547-171622569 CATCATCAGCAGCAGCACTTTGG + Intergenic
942139780 2:172966459-172966481 GAGCAGCAGCAGCAGCATCTGGG - Intronic
942178163 2:173354868-173354890 CAGGAGGAGCAGCAGCAGCGCGG - Exonic
942241035 2:173964439-173964461 CTGCAGCAGCAGCAACAGCACGG - Exonic
942319796 2:174726275-174726297 CTGCCCCAGCAGCAGGAGTGAGG - Intergenic
942461169 2:176169844-176169866 CAGCAACAGCACCAGCAGCCTGG - Intronic
942471919 2:176269475-176269497 CAGCAGCGGCGGCTGCAGTGAGG - Exonic
942521228 2:176806284-176806306 CAGCAGTAGCAGCAGCGCAGGGG + Intergenic
942721651 2:178959680-178959702 CAGGAGAAGCGGCAGCAGTCAGG + Intronic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
942914874 2:181293790-181293812 CAACCGCAGCAGCAGCGATGTGG + Intergenic
943093747 2:183404535-183404557 CAGCAGCAGCAGCAGCCATGTGG + Intergenic
943396714 2:187346839-187346861 AATCAGCAGCAGCAGCAGCAGGG + Intronic
944155340 2:196601700-196601722 CAGCAGCAGCAGCAACTATGAGG - Intergenic
944442228 2:199754104-199754126 CAGCAGAGACAGCAGAAGTGTGG + Intergenic
944471301 2:200055930-200055952 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
944643784 2:201756854-201756876 CAGCAGCATCAGCAGCATCTGGG - Intronic
944655538 2:201873520-201873542 CAGCTGCAGCAGCAGCAGCATGG - Intronic
944743660 2:202635320-202635342 CAGCAGCAGCAGCAGCAACATGG + Exonic
945052412 2:205836575-205836597 CAGCAGAAGCAGCGGGGGTGGGG - Intergenic
945181573 2:207097063-207097085 CAGCAGCATCAGCATCAGCTGGG - Intronic
945251368 2:207768689-207768711 TAGGAGCAGCAGCAACAGCGAGG + Exonic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
945435821 2:209816623-209816645 CAGCAGCATCAGCATCACTTGGG - Intronic
945443198 2:209904917-209904939 AAGCAGCAACATCAGCAGTGTGG + Exonic
945923451 2:215779644-215779666 TTGAAGCAGCAGCAGCAATGAGG - Intergenic
945986484 2:216358520-216358542 CAGCAGAAGTAGAAGCAGCGTGG + Intronic
946103659 2:217351002-217351024 TGCCAGCAGCAGCAGCAGTGTGG + Intronic
946307837 2:218866088-218866110 CAGCCGCCTCAGCAGCAGTCAGG + Intronic
946330420 2:219005899-219005921 GAGCATGGGCAGCAGCAGTGGGG - Intronic
946411627 2:219518001-219518023 AAGCAAGAGCAGCAGCAGAGGGG - Intronic
946431980 2:219631014-219631036 CAGCAGTAGCAGCAGGATGGGGG + Intronic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
947043354 2:225949462-225949484 CAGCAGCAGCAGCCGTAGGTTGG - Intergenic
947118379 2:226795330-226795352 CGGTAGCAGCAGCAGCAGCGAGG - Exonic
947140451 2:227015343-227015365 CAGCAGCAGCGGCAGCACCTGGG + Intronic
947204580 2:227648553-227648575 AAGCAGCAGCAGCACCAGGTAGG + Intergenic
947205599 2:227658288-227658310 CAGCAGCAGCAGCAACACCTGGG - Intergenic
947399054 2:229714358-229714380 CAGCAGCAGCAGGGCCAGCGCGG + Exonic
947722584 2:232378813-232378835 CAGCAGCAGCAGCAGCATGCAGG - Exonic
947927303 2:233933034-233933056 CAGCAGCAGGGGCAAAAGTGCGG - Intronic
948006851 2:234616801-234616823 CGGCAGTAGCAGCAGAAGCGAGG + Intergenic
948030737 2:234815420-234815442 CAGGTGCTGCAGCAGCACTGTGG + Intergenic
948174703 2:235934112-235934134 CAGCAGCAGCAGCAGCCCCTGGG + Intronic
948501419 2:238397663-238397685 CTGCAGCAGGAGCAGAGGTGGGG + Exonic
948501435 2:238397707-238397729 CTGCAGCAGGAGCAGAGGTGGGG + Intronic
948501451 2:238397751-238397773 CTGCAGCAGGAGCAGAGGTGGGG + Intronic
948501465 2:238397795-238397817 CTGCAGCAGGAGCAGAGGTGAGG + Intronic
948501479 2:238397839-238397861 CTGCAGCAGGAGCAGAGGTGAGG + Intronic
948501495 2:238397883-238397905 CTGCAGCAGGAGCAGAGGTGGGG + Intronic
948501521 2:238397971-238397993 CTGCAGCAGGAGCAGAGGTGAGG + Intronic
948501535 2:238398015-238398037 CTGCAGCAGGAGCAGAGGTGAGG + Intronic
948501549 2:238398059-238398081 CTGCAGCAGGAGCAGAGGTGAGG + Intronic
948501563 2:238398103-238398125 CTGCAGCAGGAGCAGAGGTGAGG + Intronic
948511235 2:238466606-238466628 CAGAAGCAGCATCTGAAGTGGGG - Intergenic
948708453 2:239810389-239810411 CAGCAGCATCAGCATCACTTGGG - Intergenic
948741304 2:240048337-240048359 CAGCAGAAGCAGCCAGAGTGGGG - Intergenic
948830927 2:240597919-240597941 CGGCTCCTGCAGCAGCAGTGGGG - Exonic
948992760 2:241563151-241563173 CGGGAGCAGCAGGAGCAGGGAGG - Intronic
1168771890 20:420871-420893 CGGAAGCAGCAGCAGCAGGAGGG + Exonic
1168957543 20:1844898-1844920 CAGCAGCAGCCCCAGAAGGGTGG - Intergenic
1168958889 20:1854770-1854792 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1169065614 20:2692925-2692947 GAGCAGCAGCAGCAGCAGCCCGG - Exonic
1169111295 20:3035892-3035914 CAGAAGCAGCAGCAGCAGTCAGG + Exonic
1169195917 20:3681951-3681973 TAGTAGCAGCAGCAGCAACGGGG + Exonic
1169197479 20:3691364-3691386 CAGAGGCAGCAGCCCCAGTGGGG + Exonic
1169355877 20:4904648-4904670 GAGCAGCAGCACCACCTGTGTGG - Intronic
1169357400 20:4919298-4919320 CAGCAGCATCACCTGCACTGGGG - Intronic
1169425630 20:5495145-5495167 CAGGAGGAGGAGCAGCAGGGAGG + Intergenic
1169460104 20:5786948-5786970 CAACAGCAGAAATAGCAGTGTGG - Intronic
1169488496 20:6052767-6052789 CGTCAGCAGCAGCAGCGGTAGGG + Exonic
1169578862 20:6996269-6996291 CAGCAGCCTCAGCATCACTGAGG + Intergenic
1169769197 20:9182829-9182851 CACCACCAGCAGCAACAGTTTGG + Intronic
1169816359 20:9660915-9660937 CAGCAGCATCAGCATCACTGGGG + Intronic
1169832506 20:9839448-9839470 CAGCAGCAGCATCACCTGCGAGG - Intergenic
1170116501 20:12865851-12865873 CATCTGCATCAGCACCAGTGGGG + Intergenic
1170150524 20:13221793-13221815 CCCCAGCAGCAGCAGCAGCTCGG - Exonic
1170330199 20:15201046-15201068 CAGCAGCAGCAGCACCTGGGAGG - Intronic
1170330200 20:15201049-15201071 CAGCAGCAGCAGCAGCACCTGGG - Intronic
1170331199 20:15212823-15212845 CAGCAGCATCAGCAGCATCTGGG + Intronic
1170331710 20:15219365-15219387 CAGCAGGAGTAGGAGCAGGGTGG - Intronic
1170437104 20:16341639-16341661 TAGCAGCATCAGCTGCACTGGGG + Intronic
1170624523 20:18021221-18021243 AGGCAGCAGCAGCAGCAGTAGGG - Intronic
1170629726 20:18056788-18056810 CAGCGGCAGCAGCAGCGCGGGGG - Exonic
1170629729 20:18056791-18056813 CGGCAGCGGCAGCAGCAGCGCGG - Exonic
1170634902 20:18095653-18095675 CAGCAGCAGCAACAGCACCTGGG - Intergenic
1170664887 20:18378290-18378312 CAGGACCAGAAGCAGCAGCGAGG + Intergenic
1170746488 20:19103853-19103875 CAGCAGCATGGGCAGCAGGGTGG - Intergenic
1170804981 20:19621716-19621738 CAGCAGCAGCAGCAGAACCCAGG - Intronic
1170816152 20:19716154-19716176 CAGCAGCGGCAGCAGCTCTCGGG - Intronic
1170853224 20:20022963-20022985 CGGCAGCAGAAACAGCAGAGGGG + Intronic
1170855299 20:20047704-20047726 CAGGAGCAGCAGCAGCATCCAGG + Intronic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1171035136 20:21707886-21707908 CAGCAGCAGCAGCGCCTCTGTGG + Intronic
1171060765 20:21957029-21957051 AAGCAGCAGCAGCTACACTGTGG + Intergenic
1171071271 20:22070645-22070667 CAGCAGCATCAGCACCAGCTAGG - Intergenic
1171231965 20:23493935-23493957 CAGCAGCAGTAGCACCACTCAGG - Intronic
1171285883 20:23937888-23937910 CAGCTGCAGCAGGAGAGGTGTGG + Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1171878489 20:30599241-30599263 CAGCAGCAGCCCCAGGAGTTAGG - Intergenic
1172042296 20:32053868-32053890 CAGCAGCAGCAGCATCACCGGGG - Intronic
1172090681 20:32429944-32429966 CAGCAGCAGCAGCGGCTCTCTGG + Exonic
1172100845 20:32483431-32483453 CAGCAGCAGCTGGAGCTGTGGGG - Exonic
1172167037 20:32905874-32905896 CAACAGCAGAAGCAGCAGGAGGG - Intronic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172514288 20:35522466-35522488 CAACGGAAGCAGCAGCAGTTGGG + Intergenic
1172520508 20:35562654-35562676 CAGCAACAGGAGCTGCAGTCAGG + Intergenic
1172555853 20:35840661-35840683 CAGCAGCAGCAGCAACATCTGGG + Intronic
1172573859 20:35991842-35991864 CAGCAGCACCAGCAGCACTTGGG + Intronic
1172624536 20:36339747-36339769 CATCTGCAGGACCAGCAGTGTGG + Intronic
1172970930 20:38872620-38872642 CAGCAGCAGCAGCAGCACCTGGG - Intronic
1173179746 20:40796825-40796847 GGGCAGGAGCAGCAGCAGAGTGG - Intergenic
1173282889 20:41645056-41645078 CAGCAGCAGCAGTAGCTATGGGG + Intergenic
1173582559 20:44157901-44157923 GAGCAGGGACAGCAGCAGTGTGG - Intronic
1173848518 20:46203009-46203031 GAGGAGCAGCAGCAGCATGGAGG - Intronic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1173856000 20:46251223-46251245 CAGCAGCAGCAGTAGCGCGGGGG + Exonic
1174033343 20:47649049-47649071 CCGCAGCACCACCAGCAGTAGGG - Exonic
1174298853 20:49568063-49568085 TAGCAGCAGCAGCAACAGTGCGG + Exonic
1174387229 20:50194335-50194357 CAGTAGCAGCGACAGCAATGTGG + Intergenic
1174523624 20:51154391-51154413 CAGCAGCCGAAGCTGCTGTGTGG - Intergenic
1174734998 20:52957392-52957414 CAGCAGCAGCAGCAGCACCTGGG + Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175166058 20:57045480-57045502 CTGCAGCATCAGCAGCATCGGGG + Intergenic
1175443530 20:59006351-59006373 CAGCAGGAGCCGCAGTATTGGGG + Exonic
1175501060 20:59451160-59451182 TAGAAGCAGCAGCAGCAGCAAGG - Intergenic
1175504380 20:59471167-59471189 GGGAAGCAGCAGCTGCAGTGAGG + Intergenic
1175564049 20:59958752-59958774 CACTAGAAGCAGCAGCAGCGAGG - Exonic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175597856 20:60249742-60249764 CAGCAGCATCAGCATCACTGGGG - Intergenic
1175668010 20:60876902-60876924 AAGCAGCAGTGGCAGCAGCGGGG - Intergenic
1175741499 20:61422851-61422873 CAGCAGCAGGAGAAGCACTGAGG - Intronic
1175767239 20:61599953-61599975 CAGCAGCAGCAGCTTCTCTGTGG - Intronic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1175834884 20:61987081-61987103 CAGCAGCAGCAGCAACAGCCAGG + Intronic
1175874596 20:62223404-62223426 CAGAGGCAGCAGCAGCAGGTGGG - Intergenic
1175997172 20:62817087-62817109 CAGGAGCAGGAGCAGGAGCGGGG - Exonic
1176093936 20:63331006-63331028 CTGCAGCTTCAGCCGCAGTGGGG + Intronic
1176190635 20:63808114-63808136 CAGCAGCCGCCTGAGCAGTGAGG + Intronic
1176360185 21:5988718-5988740 CAGCAGCAGCAGCATCTGGCAGG - Intergenic
1176383090 21:6123108-6123130 CAGCAGCAGCAGCAGGAATGGGG - Exonic
1176798622 21:13397967-13397989 CAGAAGCAGCAGCTGCATAGTGG - Intergenic
1176818108 21:13626731-13626753 CAGCAGCAAGAGCAGGAGCGAGG - Intronic
1177174401 21:17689037-17689059 AAGCATCAGCTGCAGTAGTGTGG + Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1177653101 21:23983181-23983203 CAGCAGCAGACACAGCAGTAAGG - Intergenic
1178514694 21:33236627-33236649 CAGTAGCAGCAGCAGTTGTTAGG + Intronic
1178521145 21:33289378-33289400 CGACACCAGCAGCAGCGGTGGGG - Intronic
1178636732 21:34310045-34310067 CAGCAGCATCAGCAGCACCTGGG - Intergenic
1178728060 21:35072770-35072792 GGCCAACAGCAGCAGCAGTGTGG + Intronic
1178801210 21:35797561-35797583 CACAGGTAGCAGCAGCAGTGTGG - Intronic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1178973380 21:37201008-37201030 GGGCAGCAGCAGCAGGAGTGTGG + Intronic
1179344487 21:40544101-40544123 CTGCAGCATCAGCAGGAGTCAGG + Intronic
1179368994 21:40786436-40786458 CAGCAGCATCAGCAGCACACGGG + Intronic
1179740379 21:43415131-43415153 CAGCAGCAGCAGCAGGAATGGGG + Exonic
1179763333 21:43549832-43549854 CAGCAGCAGCAGCATCTGGCAGG + Intronic
1180009501 21:45040319-45040341 CCACAGCAGCAGCAGCAGCATGG - Intergenic
1180018158 21:45101011-45101033 CAGCAGCAGCAGCGCCAGTGCGG + Intronic
1180054075 21:45348106-45348128 CAGCAGCAGCAGCCCGAGAGTGG + Intergenic
1180065055 21:45408209-45408231 GAGCAGCAGCAGGTGAAGTGGGG - Intronic
1180108395 21:45634608-45634630 CAGCCGCCGCAGCAGATGTGGGG - Intergenic
1180188852 21:46153294-46153316 CAGGAGCAGCAGCACCTGAGCGG + Intronic
1180614872 22:17120598-17120620 CAGCCGCAGCAGCAGCAACACGG + Exonic
1180614979 22:17120962-17120984 CAGCACCAGCACCAGCCGCGGGG - Exonic
1180740853 22:18052400-18052422 CAGCAGCAGCAGAGGCACCGGGG + Intergenic
1180820684 22:18825259-18825281 CAAGGGCATCAGCAGCAGTGAGG - Intergenic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1180871633 22:19150075-19150097 CAGCAGCAGCAGCAGGCGCAGGG + Exonic
1180962701 22:19769349-19769371 CAGCAGCAACAGCAGCAGTGTGG - Intronic
1181043015 22:20201754-20201776 CAGCACCAGGAGCAGGGGTGAGG + Intergenic
1181104281 22:20564333-20564355 CAGCGGCAGCCGTGGCAGTGGGG + Intronic
1181192289 22:21150788-21150810 CAAGGGCATCAGCAGCAGTGAGG + Intergenic
1181206907 22:21259731-21259753 CAAGGGCATCAGCAGCAGTGAGG - Intergenic
1181412894 22:22737268-22737290 CAGCATCAGCAACATCTGTGAGG - Intronic
1181493942 22:23277504-23277526 CAGCAGCAGCAGCAGGGGATGGG - Intronic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181560174 22:23695431-23695453 CAGCAGCAGCAGCAGAGGCCTGG - Intronic
1181572026 22:23772920-23772942 GAGCAGCAGCAGCAGCATCGGGG - Exonic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182289158 22:29265552-29265574 CATCAGCAGCATCAGGACTGAGG + Exonic
1182294061 22:29302837-29302859 CAGCAGTACCAGCAGCTGTGGGG + Intergenic
1182445116 22:30385496-30385518 CAGCAGCAGCAGTGGCAACGGGG + Intronic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1182505620 22:30780219-30780241 CAGCAGAAGCATTAGCACTGGGG - Intronic
1182715212 22:32352685-32352707 CAGCAGCAGCAGCAAGTTTGGGG - Intergenic
1182766935 22:32764461-32764483 CTCCAGCACCCGCAGCAGTGAGG - Intronic
1182788062 22:32924487-32924509 CAGCAGCATCAGCAGCATCCAGG + Intronic
1182872656 22:33662349-33662371 CAGGAGCCCCAGCATCAGTGAGG + Intronic
1183339465 22:37271909-37271931 GAGCTGCAGCAGCATCAGTCAGG - Intergenic
1183357898 22:37369282-37369304 CAGCTGGGGCAGCAGCAGTGGGG - Exonic
1183485601 22:38086271-38086293 CAGCAGCCGCCGCAGCAGCATGG - Exonic
1183719509 22:39554343-39554365 CAGCAGCTGCTGCAGCAGCAAGG + Intergenic
1183784840 22:40023338-40023360 CAGCAGCAGCAGCTGGTGTTAGG - Intronic
1183816016 22:40301186-40301208 CAGCAGCAGCAGAGGCAGCCAGG + Exonic
1183858709 22:40653569-40653591 CAGCAGCATCTGCTGCAGTATGG + Intergenic
1184076522 22:42182692-42182714 CAGCAGCATCAGCAACACTCAGG + Intronic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184402319 22:44281198-44281220 CAGCAGGAGCATCAGCACTAGGG - Intronic
1184668634 22:46001522-46001544 CAGCTGGAGCAGGTGCAGTGAGG - Intergenic
1184730266 22:46367819-46367841 GAGCAGCAGCAGGAGGAATGCGG + Exonic
1184835657 22:47019579-47019601 GGGCAGCAGAATCAGCAGTGGGG + Intronic
1184901411 22:47448682-47448704 GAGCAGCAGCGAGAGCAGTGAGG + Intergenic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1185032002 22:48449054-48449076 CCACAGAAGCAGCAGCTGTGGGG + Intergenic
1185045314 22:48525681-48525703 CAGCAGCAGCAGCAGCTTCTGGG - Intronic
1185236462 22:49716420-49716442 TTGCAGCACCAGCAGCAGCGAGG - Intergenic
1185251535 22:49804237-49804259 CTGCAGCCGCCGCAGCAGGGGGG + Exonic
1185379621 22:50502462-50502484 CAGCAGCAGAGACAGCAGTCAGG - Intergenic
1203220016 22_KI270731v1_random:35692-35714 CAAGGGCATCAGCAGCAGTGAGG + Intergenic
1203270810 22_KI270734v1_random:51134-51156 CAAGGGCATCAGCAGCAGTGAGG - Intergenic
949376867 3:3400565-3400587 TGGCAGCAGCAGTGGCAGTGGGG + Intergenic
949615937 3:5753839-5753861 AAGCAGCAGCAGCAGCTCTAAGG - Intergenic
949743507 3:7263412-7263434 CAGCAGTGGCAGCAGCAGCATGG + Intronic
949934691 3:9107615-9107637 CAGCAGCAGCAGCATCACTTAGG + Intronic
949949936 3:9220897-9220919 CAGCAGCAGGACTAGCAATGTGG - Intronic
949980265 3:9498421-9498443 CAGCAGCAGCAGAAGGGGTCAGG + Exonic
950435676 3:12978321-12978343 CAGCAGCAGCAGCCTCAGCTGGG + Intronic
950529698 3:13546139-13546161 CAGCAGCTGCAGCCACAGTGGGG - Intergenic
950719173 3:14870375-14870397 CAGCACCAGCGACAGCAGTAAGG - Intronic
951068040 3:18290529-18290551 CAGCAGCAACAGCATCACTTGGG - Intronic
951078507 3:18425122-18425144 CAGCAGGAGCAGCGGCGGAGAGG - Intronic
951105055 3:18732637-18732659 CAGCAGCATCAGCATCACTTGGG + Intergenic
951477199 3:23119469-23119491 GAACAGCAGCAGCAGCAGGGGGG - Intergenic
951529179 3:23682747-23682769 CAGCAGCAACAGCAGCACCTGGG - Intergenic
951592104 3:24277513-24277535 CAGCAGCATCAGCATCACCGGGG - Intronic
951725831 3:25757920-25757942 CAGCTGCAGAAGTAGGAGTGCGG - Intronic
951844622 3:27072277-27072299 AAGCAGCATCAGCACCACTGGGG + Intergenic
951980921 3:28565791-28565813 CAGCTGGAGCAGCTCCAGTGGGG - Intergenic
951995196 3:28719729-28719751 CAGCAGCAGCAGCATCACCTGGG - Intergenic
952055118 3:29434811-29434833 CAGCAGCAACAACAGCAGCGGGG + Exonic
952192732 3:31041367-31041389 CAGCAGCAATAGCAGCAGCTGGG + Intergenic
952320974 3:32277310-32277332 CAGCAGCAGCAACCACCGTGGGG - Intronic
952583980 3:34869232-34869254 GACCAGCAGCATCAGCAGAGTGG + Intergenic
952627508 3:35424763-35424785 CAGCAAAAGCAGCAGCAATTGGG + Intergenic
952644648 3:35640087-35640109 CAGCAGCAGCAGGGGCAGCGGGG + Intronic
952852608 3:37741294-37741316 CAGCAGCAACAGCAGCTCTCAGG + Intronic
952859206 3:37798450-37798472 CAGCAGCATCAGCATCATGGGGG + Intronic
952884690 3:38005284-38005306 TGGCTGCAGCAGAAGCAGTGAGG - Intronic
952926800 3:38326368-38326390 CTGCAGGAGCAGCACCTGTGGGG + Intergenic
952942490 3:38454762-38454784 CAGCAGCAGCAGCAGCATGCGGG + Intronic
953347049 3:42184979-42185001 CAGCAGCAGGAGCTGCAGGAAGG - Intronic
953515171 3:43583738-43583760 TAGGTGCAGCAGCAGCTGTGGGG - Intronic
953801817 3:46030716-46030738 CAGCTGCAGGAGCAGCAGTGGGG + Intergenic
953886602 3:46717732-46717754 CAACAGAAGCAGCAGCAGCAGGG + Exonic
954206532 3:49063281-49063303 CAACAGCAGCAGCAGCATCCAGG + Intronic
954304490 3:49718231-49718253 CGGCGGCAGCAGCGGCAGGGTGG + Exonic
954333565 3:49903559-49903581 CAACAGCAGCAGCAACAGGAAGG + Exonic
954408426 3:50358533-50358555 CAGCAGCGCCAGCAGCAGCATGG + Exonic
954419869 3:50413112-50413134 CAGCGGCAGCAGCAGCTGGGTGG - Intronic
954437156 3:50502538-50502560 CAGCAGCAGCAGGCGCAGGCAGG + Intronic
954532335 3:51332087-51332109 CAGCAGCATTAACAGCAGTCAGG + Intronic
955208194 3:56916538-56916560 CAGCAGTAGCAGGAGAGGTGGGG - Intronic
955353452 3:58210868-58210890 GAGGAGGAGAAGCAGCAGTGGGG + Exonic
955518556 3:59752241-59752263 CAGCAGAAGCCGCAGCTCTGCGG - Exonic
956193467 3:66629571-66629593 TTGCTGCAGCAGCAGCAGCGGGG + Intergenic
956193468 3:66629574-66629596 CTGCAGCAGCAGCAGCGGGGAGG + Intergenic
956339884 3:68210669-68210691 CAGTAGTAGCAGCAACAGTAGGG - Intronic
956465617 3:69517990-69518012 CAGCAGCAGCAGCATCTCTTGGG - Intronic
956489520 3:69755857-69755879 CAGGAGGAGGAGCAGCAGTAAGG - Intronic
956602579 3:71038065-71038087 CTGCAGTAGCAGCAGCTCTGGGG - Intronic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
956609145 3:71104395-71104417 CAGCAGCAACAGCAGCAGAAGGG - Intronic
956681381 3:71785011-71785033 CAGCAAGAGGAGCAGGAGTGGGG + Exonic
956716563 3:72085218-72085240 CAGCAGCAGCTGCAGCTGCATGG + Intergenic
956754830 3:72374121-72374143 CAGCACCTGCAGCAGCAGGCAGG + Exonic
956780276 3:72597942-72597964 CAGCAGTAGCAGCAGCAGCAGGG + Intergenic
956813608 3:72888280-72888302 CAGCAGCGCCAGCAGCAGCGCGG - Exonic
956933060 3:74068084-74068106 CAGCAGCATCAGCATCATTCAGG + Intergenic
957172992 3:76763796-76763818 CAGCAGCAATGGCAGCAGTTTGG - Intronic
957348491 3:78992900-78992922 CAGAAGCTGAAGCAGCAGTAAGG + Intronic
958510164 3:95037652-95037674 CAGCTGCAGTATTAGCAGTGGGG + Intergenic
958678599 3:97296618-97296640 CAGCAGCAGCAGTGGCAGTGAGG + Intronic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959362529 3:105411443-105411465 TAGTAGCAGCAGCAGCAGCTGGG + Intronic
959389200 3:105752870-105752892 CAGCAGCAGCAGCAGCCTCAGGG - Intronic
959836432 3:110923795-110923817 CAGCAGAAGAGGCAGCAGTGCGG + Intergenic
959969925 3:112397944-112397966 CAGCAGGAGAGGCATCAGTGAGG + Intergenic
960198908 3:114807430-114807452 CAGCAGCAGCTGCAGGGGAGGGG - Intronic
960687417 3:120307920-120307942 GAGCAGGAGCAGCAGCAGCAAGG + Intergenic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
960879042 3:122326849-122326871 TGGCAGCAGCAGCAGCACTTGGG - Intronic
960949205 3:122988156-122988178 CAGCAGCAGCAGCATCACTTGGG - Intronic
961110995 3:124282894-124282916 CAGCAGCAGCCTCTGCAATGGGG - Intronic
961125701 3:124415797-124415819 CAGCAGCACCAGCATCACTTGGG + Intronic
961133455 3:124489724-124489746 CAGCAGCAGCAACAGCACCTGGG + Intronic
961493058 3:127268767-127268789 CTGCAGGAACAGCAGCACTGTGG + Intergenic
961569213 3:127786101-127786123 CAGCCCCAGGGGCAGCAGTGGGG + Intronic
961643931 3:128382386-128382408 CGGCACCAGCAGGAGCTGTGTGG + Intronic
961856710 3:129878734-129878756 CAGCAGCAGCAGCAGCACCTGGG + Intronic
961895992 3:130168015-130168037 CAGCGGCAGCAGCAGCTGGAGGG + Intergenic
961994084 3:131222726-131222748 CAGCAGCATCAGCATCAGCTGGG + Intronic
962212740 3:133492310-133492332 CAGCAGCTGCAGCAGCATGGCGG - Intergenic
962230575 3:133661994-133662016 CGGCAGCTGCAGCAGAAGAGCGG + Intergenic
962289584 3:134122943-134122965 ACCCAACAGCAGCAGCAGTGGGG + Intronic
963117020 3:141738672-141738694 CAGGAGCCGCAGCAGGAGCGTGG - Intronic
963430008 3:145188614-145188636 CAGCAGCACCAGCAGCATCTGGG + Intergenic
963494247 3:146040360-146040382 CAGAAGCAGAATCAGCAATGTGG - Intergenic
963686943 3:148447636-148447658 TAGAGTCAGCAGCAGCAGTGTGG - Intergenic
963751813 3:149187792-149187814 CAGCAGCCTCAGCATCACTGAGG - Intronic
963756748 3:149242490-149242512 CAGCAGCATCAGCATCACTTGGG - Intergenic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
963989568 3:151637657-151637679 CAGCAGTACCAGCAGCATTTGGG - Intergenic
964574266 3:158147005-158147027 CAGCAGCACAAGCAGCCATGGGG - Intronic
964622625 3:158732329-158732351 CAGCAGCAGCGCGAGCAGCGGGG + Exonic
964650935 3:159010385-159010407 CAGCAGCAGCAACACCAGGTAGG - Intronic
965419137 3:168435513-168435535 CAGTAACAGCAGCAGCAGCAGGG + Intergenic
965833905 3:172829888-172829910 CAACAGCAACAGCAAAAGTGAGG + Intergenic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966921872 3:184617473-184617495 CAGCAGCAGCAGCAGCAAGATGG + Intronic
967115422 3:186333192-186333214 CAGCAGCATCAGCACCACCGGGG + Intronic
967136128 3:186514412-186514434 CAGCAGCAATAGCACCAGTCAGG + Intergenic
967659603 3:192090707-192090729 CAGCAGCTGCAGCAGCACAGTGG - Intergenic
967699210 3:192571796-192571818 CAGCAGCCCCAGCAGCAATCTGG + Intronic
967874636 3:194259264-194259286 CAGCAGCATCAGCATCGATGGGG - Intergenic
967932660 3:194701743-194701765 CAGCAGGCTCAGCTGCAGTGTGG - Intergenic
968066968 3:195764128-195764150 CAGCGGCAGCACCAGCTCTGTGG + Exonic
968137244 3:196228227-196228249 CAGGGGCAGCAGCAGCAGCAGGG - Exonic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
968509608 4:989655-989677 CAGCAGCACCAGCAGCACCACGG + Exonic
968509609 4:989658-989680 CAGCACCAGCAGCACCACGGTGG + Exonic
968967850 4:3778339-3778361 CAGCTGCAGCAGCAGCAGCTGGG + Intergenic
969006136 4:4021336-4021358 CAGCAGCAGCAGCAGCTGGAGGG + Intergenic
969184307 4:5464088-5464110 CAGGAGCAGGAACAGCAGTGGGG + Intronic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
969402282 4:6963375-6963397 CCGGAGCAGCAGCACCAGTGTGG + Intronic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG + Intergenic
969671547 4:8592841-8592863 AAGGAGCAGCAGCGGCAGCGGGG - Exonic
969806812 4:9615954-9615976 CAGCAGCAGCAGCAGCTGGAGGG - Intergenic
969954729 4:10877176-10877198 CAGCAGCATCAGCATCACTTGGG + Intergenic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970384120 4:15538872-15538894 CAGCAGCATCAGCATCACTGAGG + Intronic
970441730 4:16085872-16085894 CCCCAGCAGCAGCAGCCTTGTGG + Intergenic
970592562 4:17572212-17572234 CAGCAGCAGCAGCAGCAAGATGG - Intergenic
970689609 4:18607415-18607437 CAGCAGCAGCGGCATCAGCTGGG - Intergenic
971183090 4:24349306-24349328 CATCAGCTGCAGTAGTAGTGTGG + Intergenic
971197446 4:24482992-24483014 CAGCAGCAGCAGCAGCCTCCAGG - Intergenic
971304432 4:25467324-25467346 CAGCCCCAGCCCCAGCAGTGGGG + Intergenic
971565933 4:28141608-28141630 CAGCAGAAGCAGCAAGAGTTAGG - Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
972105985 4:35487744-35487766 GAGCAGCAGCAGCAGCACGCAGG + Intergenic
972205313 4:36764903-36764925 CAGCAGCTGGAGAAGCACTGTGG + Intergenic
972580881 4:40394773-40394795 GAGCAGCAGCAGCAGGACTATGG + Intergenic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973830284 4:54752502-54752524 CAGCAGCAGCTGAAGCAGGAGGG + Intergenic
973888466 4:55346422-55346444 CGGCAGGAGCTGCAGCAGTAGGG - Exonic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
974165582 4:58197316-58197338 CAGCAGCAACAATAACAGTGTGG + Intergenic
975082706 4:70299950-70299972 CAGCAGCAGTTGTAGCACTGTGG - Intergenic
975433282 4:74320507-74320529 CCTAAGCAGCAGCAGCAGTTGGG - Intergenic
975511117 4:75194415-75194437 CAGCGGCAGCAGTGGCAGTGTGG - Intergenic
976088181 4:81427732-81427754 AAGCAGCAGCAGCAGCAGGCAGG + Exonic
976122650 4:81800033-81800055 CAGCAGCAGCAGCAGAGGAAAGG + Intronic
976140997 4:81991491-81991513 TAGAGGCAGCAGCAGCAGTGGGG + Intronic
976141001 4:81991497-81991519 CAGCAGCAGCAGTGGGGGTGGGG + Intronic
976176347 4:82356840-82356862 TATCAGCAACAGCAACAGTGGGG - Exonic
976441840 4:85084980-85085002 CAGCAGGAACAGCAGCAGCTGGG - Intergenic
976734636 4:88297073-88297095 CAGCAGCGGCTGCAGCAAGGAGG - Intergenic
976880861 4:89923242-89923264 CAGCAGCAGCAGCAAGGCTGTGG + Exonic
977696577 4:99972237-99972259 CAGAGGCAGCAGCAGCACAGGGG - Intergenic
978205547 4:106076396-106076418 CAGCAACAGCAGCAGTATTGTGG + Intronic
978405387 4:108373239-108373261 CATCTGCTCCAGCAGCAGTGCGG - Intergenic
978689005 4:111484026-111484048 CAGCAGCACGAGCAGCAGCATGG - Intergenic
978923777 4:114217731-114217753 CAGCAGCAGCATAGGCAGTGTGG - Intergenic
978940820 4:114434494-114434516 CAGTAGCAGTAGCAGCATTATGG + Intergenic
979076331 4:116275320-116275342 CAGCAGAAGTAGCAGCAGTGTGG - Intergenic
979471889 4:121108705-121108727 CAGCAGCAGCAACATCAGCTGGG - Intergenic
979544732 4:121926827-121926849 CAGCAGCATCAGCAGCACCTGGG + Intronic
979567978 4:122178360-122178382 GAGCTGCAGAAGCAGCAATGAGG + Intronic
979671717 4:123366607-123366629 CTAGAGCAGCAGCAGCAGAGAGG + Intergenic
979678065 4:123431163-123431185 AAGAAGCAGCAGCAGCAGCAGGG - Intergenic
979975472 4:127190732-127190754 CTGCAGTAGCAGCAGCAGCTGGG + Intergenic
980027119 4:127781014-127781036 CTACAGCAGCAGCAGCAGCAAGG - Intergenic
980532147 4:134070300-134070322 TGCCAGCAGCAGCGGCAGTGTGG + Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
980920776 4:139083870-139083892 GAGCAGCAGCAGCAGCTGCCGGG - Intronic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981354705 4:143774723-143774745 GAGCAACAGCAGCAGAAGTTTGG + Intergenic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
982215602 4:153080302-153080324 CAGTAGCAGCAGCAGCAGCCAGG + Intergenic
982257627 4:153466237-153466259 CAGCAGCTGCGGCAGCGGCGGGG + Intergenic
982363983 4:154555224-154555246 CTCCAGAAGCAGCAGTAGTGAGG - Intergenic
982390541 4:154858436-154858458 GAGCAGCAGCAAGAGCAGTGAGG - Intergenic
982390929 4:154863074-154863096 CAGCTGGAGCTGGAGCAGTGGGG + Intergenic
983130438 4:164012526-164012548 TAGCAGCAGCAGCAGCAGCCAGG + Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983259485 4:165440421-165440443 GAGCAGCAGCAGCAGCTAAGGGG - Intronic
983269147 4:165540385-165540407 CAGCAGAAGCAGAAGCATTTTGG + Intergenic
983379997 4:166980646-166980668 GACCAGCAGCTGCAGCAGGGTGG + Intronic
983523679 4:168737922-168737944 CAGAGACAGCAGCAGCTGTGAGG + Intronic
984057541 4:174948652-174948674 CAGCAGCTGCAGCAGCATGGTGG + Intronic
984432305 4:179664768-179664790 GAGCAGCAGCAGCAGCTCAGAGG - Intergenic
984592755 4:181635141-181635163 CTGCATCAGCAGCAGAAGGGAGG + Intergenic
984797062 4:183671462-183671484 CAGAAGCAGGAGCAGCAGTTGGG - Intronic
984810960 4:183796552-183796574 CAGCAGTAGCAGCAGCATCTGGG + Intergenic
984820518 4:183877660-183877682 CAGCAGCAGCAGCGGAAGTGCGG - Intronic
985093823 4:186392093-186392115 CAGCAGCAGCAGCAGCATCTTGG + Intergenic
985210380 4:187586497-187586519 CACCACCACCAGCAGCCGTGGGG - Intergenic
985279473 4:188270965-188270987 CACCAGCAGCAGCAGCAGCCTGG + Intergenic
985846438 5:2353198-2353220 TAGCAGCTGTACCAGCAGTGGGG - Intergenic
986296937 5:6447072-6447094 CACCAGCAGCAGCGGCAGCAAGG + Intergenic
986297051 5:6448624-6448646 CAGCAGCAGCAGCACCCCGGGGG + Exonic
986466924 5:8034997-8035019 GAGCAGCAGCAGCACCAGGGAGG + Intergenic
986561408 5:9063761-9063783 AGGCAGCAGCAGCAGCAGGTGGG + Intronic
986693184 5:10330820-10330842 CCTCAGCATCAGCAGAAGTGTGG - Intergenic
986903772 5:12468489-12468511 CAGCAGTGGCAGTGGCAGTGTGG - Intergenic
986974721 5:13381727-13381749 TAGCAGCTGCAGCAGGGGTGAGG + Intergenic
987209780 5:15669011-15669033 CAGCAGCAGCAGAAACAATAAGG - Intronic
987385839 5:17328530-17328552 CAGCAGCAGCAGCATCACCTGGG - Intergenic
987525559 5:19045229-19045251 CACAAGCAGCAGCCCCAGTGGGG - Intergenic
988496236 5:31748556-31748578 CCCCAGCAGCAGAAGCTGTGGGG + Intronic
988723519 5:33903172-33903194 AAGCATCAGCTGTAGCAGTGTGG + Intergenic
988906617 5:35797251-35797273 CAGCAGCAGAGGCAGGACTGTGG + Intronic
989322348 5:40151129-40151151 CAGCAGCAGGGGCAGCCCTGTGG + Intergenic
989341976 5:40386378-40386400 CAGCAACAGCAGCAGCAGCTGGG - Intergenic
989710177 5:44388612-44388634 AAGCAGCAGCAGCAGCAGCCGGG + Exonic
989963555 5:50442968-50442990 CAACAGCAAAAGCAACAGTGGGG - Intronic
990165537 5:52989491-52989513 CAGCAGCAGCGGCAGCGGCGCGG - Exonic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
990923359 5:60993134-60993156 CACCAGCTGCTGCAGCAGGGCGG + Intronic
991027982 5:62051831-62051853 CAGCAGCAGAAACAGCACAGTGG + Intergenic
991421215 5:66444200-66444222 CACCAGCAGCAGCAGCATTAGGG + Intergenic
991433402 5:66571599-66571621 CAGCAGCATCAGCAGCACCTTGG + Intergenic
991654257 5:68887278-68887300 CAGCAGCAGCAGTAGCTGCAAGG + Intergenic
992146723 5:73858055-73858077 CAGCAGCAGCAGTAGGAAAGTGG - Intronic
993335005 5:86646123-86646145 CAAAAGCAGCAGCAACAGTGGGG - Intergenic
994150559 5:96442783-96442805 CAACAGCAGCAGCAGTGGTAGGG - Intergenic
994320717 5:98392013-98392035 CAGCCGCAGGAGCAGTAGTCTGG + Intergenic
994353907 5:98774150-98774172 CAGCAGCAGCTCCAGCGGCGGGG - Exonic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
994613811 5:102078429-102078451 CCCCAGCAGCAGCAGTATTGTGG - Intergenic
994643015 5:102433746-102433768 CAACAGCAGCAGCGGCAGCATGG + Intronic
994657129 5:102607786-102607808 CAGCAACATCAGCACCACTGGGG - Intergenic
995026228 5:107426365-107426387 CAGTAGCAGCAGCAGCATCTGGG + Intronic
995052747 5:107724809-107724831 CAGCAGCAGCAGCAGAAAGTGGG + Intergenic
995068440 5:107889755-107889777 CTTAAGCAGCAGCAGCAGCGAGG + Intronic
995074837 5:107970444-107970466 CAGAAGCGGTAGCAGCTGTGGGG - Intronic
995133880 5:108659835-108659857 AAGCAGCATCAGCACCACTGGGG + Intergenic
995258584 5:110075259-110075281 TAGCAGCAGCAGCAGCTTGGTGG + Intergenic
995272886 5:110242430-110242452 AAGCAGGAGCAGGAGGAGTGGGG + Intergenic
995301999 5:110595094-110595116 CACCAGCAGAAGCTGCAGTATGG - Intronic
995888387 5:116921549-116921571 CAGGAGCAGCATGAGCAGTCAGG - Intergenic
996167011 5:120236611-120236633 TTCCAGCAGCAGCAGCAGCGTGG + Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
996588549 5:125119326-125119348 CAGCAGCATCAGCATCACTTGGG + Intergenic
996726841 5:126680075-126680097 CAGGACCAGCCGCAGCAGTCAGG + Intergenic
996894662 5:128465837-128465859 CAGCAGCAACAGCATCACTTTGG + Intronic
997001064 5:129762594-129762616 CAGCAGCAGCACAATCAGTCAGG + Intronic
997182164 5:131841339-131841361 TGCCAGCAGTAGCAGCAGTGTGG + Intronic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997825701 5:137105142-137105164 GAGCAGCAGCAGCAGCAATTAGG - Intronic
997916572 5:137932662-137932684 CTTTATCAGCAGCAGCAGTGAGG - Intronic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998061213 5:139120116-139120138 CAGCAGCAGTGGGGGCAGTGAGG + Intronic
998261164 5:140632948-140632970 CAGCAGCAGCAGCAACAAGCAGG + Exonic
998264968 5:140660937-140660959 CAGTAGAAACAGCAGCATTGAGG + Intronic
998799638 5:145856365-145856387 CAGGAGCAGCAGCAGCAGCTAGG - Intergenic
998820606 5:146054357-146054379 CAGCAGTAGCAGCAGCAGCAAGG - Intronic
998940870 5:147280615-147280637 CCACAGCAGCAGCAGCAGCAAGG + Intronic
998987924 5:147782675-147782697 CAGCAGCAGCATCACCAGTTGGG + Exonic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
999337549 5:150735159-150735181 AAGCATCAGCTGCAGTAGTGTGG - Intronic
999363620 5:151006824-151006846 CAGCAGCAGCACAATCAGTGGGG - Intergenic
999507712 5:152215400-152215422 CAGCAGCATCAGGAGCCCTGAGG - Intergenic
999843062 5:155449722-155449744 CAGCTGGAGCTGGAGCAGTGAGG + Intergenic
1000220183 5:159208205-159208227 CAGCAGTAGCAGCAGCAACCGGG + Intronic
1000839786 5:166203919-166203941 CATCAGCAGCAGCAGTATTAAGG - Intergenic
1000990171 5:167903715-167903737 CAGCAGCATCAGCAGCATCTGGG + Intronic
1001108567 5:168876310-168876332 AAACAGCTTCAGCAGCAGTGGGG - Intronic
1001236171 5:170031422-170031444 CAACAGGAGCAGAAGCAGTGTGG + Intronic
1001548967 5:172588338-172588360 GGACAGCAGCAGCAGCTGTGTGG - Intergenic
1001700072 5:173700471-173700493 CAGCAGCACCAGCATCACTTGGG - Intergenic
1001823072 5:174724880-174724902 CAGCAGCAGTGGCCGCAGGGTGG - Exonic
1002096196 5:176832580-176832602 TAGCAGCAGCGGCAGCTGAGGGG - Intronic
1002322070 5:178382224-178382246 CAGCCGCAGCAGCTGCAGCTGGG - Intronic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002586433 5:180251811-180251833 CAGCACCCGCAGCATGAGTGGGG + Intronic
1002660460 5:180788026-180788048 ATGCAGCAGCAGCAGCAGCCAGG + Intergenic
1002780263 6:359731-359753 CAGAAGCAGAAGCAGCATTAGGG + Intergenic
1002947676 6:1778771-1778793 CAGCAGCAGCCTGACCAGTGTGG + Intronic
1003120586 6:3316115-3316137 CAGCAGCATCAGCATCACTTGGG - Intronic
1003156787 6:3603609-3603631 CAGCAGCAGCAGCTGCGGATGGG + Intergenic
1003340062 6:5212093-5212115 CTGCAGCATCAGCATCACTGAGG - Intronic
1003400504 6:5786746-5786768 CTGCAGCAGCAGCATCCCTGAGG - Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003624158 6:7727298-7727320 CAGCAGCAGCAGCTGCCTCGCGG + Exonic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1004004788 6:11628649-11628671 CAGCAGCAGCAGCTACAGGAAGG - Intergenic
1004120164 6:12813843-12813865 CAGCAGCATCAGCATCCTTGCGG + Intronic
1004228984 6:13814211-13814233 CAGGAGGAGGAGCAGCGGTGAGG + Exonic
1004268738 6:14174824-14174846 CTGAAGCATCAGCAGAAGTGTGG + Intergenic
1004320349 6:14627000-14627022 CATCTGCAGCAGCAGCAGTGTGG + Intergenic
1004346906 6:14857294-14857316 CTTCAGCAACAACAGCAGTGAGG - Intergenic
1004518897 6:16344029-16344051 CAGCAGCATCAGCAGCATCTGGG - Intronic
1004525093 6:16399993-16400015 CAGCAGCATCAGCATCACTAGGG + Intronic
1004675864 6:17841548-17841570 AAGCAGCAGCAGCAGAGGGGTGG + Intronic
1004732208 6:18368677-18368699 CAGCAGCAGCAGCGGCTGCGCGG - Intergenic
1005455688 6:26017687-26017709 CAGGAGCAGCAGAAGCGGCGGGG + Exonic
1005781809 6:29201030-29201052 CAGCTGCAGCTGCACCAGGGAGG - Intergenic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1005994680 6:30924010-30924032 CAGCAGCAGCAGCACCACTTGGG - Intronic
1006021515 6:31120609-31120631 CAGCAGCAGTGGCTGCAGTGTGG + Intronic
1006148035 6:31970837-31970859 GAGAAGCAGCAGCAGGCGTGGGG + Intronic
1006193620 6:32223899-32223921 CAGCAGCAGCAGCAGTGAAGGGG + Exonic
1006738663 6:36292515-36292537 CAGCAGCAGGCAAAGCAGTGTGG - Intronic
1006820429 6:36889198-36889220 CAACAGCAGCTGCTGCAGAGAGG + Intronic
1006911361 6:37565773-37565795 CGGCAGCAGCAGCCTCAGGGAGG - Intergenic
1007221460 6:40282243-40282265 GAGCAGCAGCAGCAGCACTGGGG - Intergenic
1007323610 6:41043941-41043963 CAGCAGCAGCAGGTGCAGCAGGG - Exonic
1007339920 6:41184885-41184907 CAGCAGCAGCAGCAGCACAACGG + Intergenic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007350748 6:41271936-41271958 GAGCAGCAGCAGCAGCAGCCAGG + Intronic
1007415914 6:41691074-41691096 CAGCAACAGCAGCAGCTCGGAGG - Exonic
1007415915 6:41691077-41691099 CAGCAGCAACAGCAGCAGCTCGG - Exonic
1007506320 6:42337938-42337960 CAACAGCAGCAGCAGCACCTAGG + Intronic
1007534729 6:42576424-42576446 GGGCAGCAGCAGCAGCAGAATGG - Intronic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007654838 6:43445762-43445784 CGGCAGCAGGAGCAGCAGCCAGG - Exonic
1007680287 6:43629051-43629073 CGGCAGCAGCAGCGGCTGCGGGG - Exonic
1007769877 6:44183959-44183981 TACCAGCAGCAGCAGCAGCGAGG + Exonic
1008036461 6:46750024-46750046 CAGCAGCAGCAGCAGCCCCTGGG - Intronic
1008071832 6:47105984-47106006 CAGAGGCAGCAGCAACAATGAGG + Intergenic
1008299620 6:49819240-49819262 TAGCAGCATCAGCATCAGTTGGG + Intergenic
1008383662 6:50862172-50862194 CAGCAGTAGCAGCAGAAGCAAGG + Intergenic
1008469373 6:51866040-51866062 CAGCAGCAGCAGCAGCACCAGGG - Intronic
1008649511 6:53548334-53548356 TAGCAGCAGCAGCAGCCCAGAGG - Intronic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1008806240 6:55432041-55432063 GAGCAGCAGCAGCAGCAAAATGG - Intergenic
1009308887 6:62125163-62125185 TAGCAGCAGCAGTAGCTGTGTGG + Intronic
1009621556 6:66084647-66084669 CAGCAGGAGCAGCAGCACAGTGG + Intergenic
1009803908 6:68577332-68577354 CAGCAGCAGCAGCAGCATTTGGG + Intergenic
1010062276 6:71636530-71636552 CTGGAGCAGGAGCAGCTGTGTGG - Intergenic
1010083140 6:71886860-71886882 CAGCAGCAGCAGCAGAGCCGGGG - Intronic
1010989925 6:82469228-82469250 CAGCAGAAACAGCAGCTTTGTGG + Intergenic
1011016912 6:82767153-82767175 CAGCAGCAGCAGCATCACCTGGG + Intergenic
1011290482 6:85772062-85772084 CAGCAGCAGCAGTGGCAGCACGG + Intergenic
1011290483 6:85772065-85772087 CAGCAGCAGTGGCAGCACGGCGG + Intergenic
1011399929 6:86949355-86949377 CAACAGCAGCAGCAGCAGCAGGG - Intronic
1011452174 6:87505073-87505095 CAGCAGCAGTGGCACCACTGGGG - Intronic
1011530228 6:88312892-88312914 CAGCAGCAGCAGCTGCACCTGGG + Intergenic
1011872571 6:91914628-91914650 CAGCTGCAGTAGCAGCAGTCAGG + Intergenic
1011941483 6:92848489-92848511 CAGCAGCATCAGTAGCAGTTGGG - Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012503266 6:99914618-99914640 CAGCAGCATCAGCATCACTTGGG + Intergenic
1012525009 6:100166875-100166897 CAGGAGCAGCACCAGGAATGTGG - Intergenic
1012616424 6:101284132-101284154 CAGCAGAAGCAGTGGCAGAGAGG - Intergenic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1012668918 6:102015653-102015675 AAGCAGTAGCAGCAGCAGCACGG - Intronic
1012696509 6:102391140-102391162 CAGCTGCTGTAGTAGCAGTGGGG - Intergenic
1012797435 6:103780417-103780439 CAGCAGCATCAGCATCAGTTAGG - Intergenic
1012964401 6:105657686-105657708 CAGCAGGAGCAGCAGAGGGGTGG - Intergenic
1012964402 6:105657689-105657711 CCACAGCAGGAGCAGCAGAGGGG - Intergenic
1013225970 6:108119554-108119576 CCGCAGCACCACCAGCACTGGGG + Intronic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013804770 6:113985045-113985067 CAGCAACAGCAGCAGCAAATGGG - Intronic
1013951070 6:115782546-115782568 CATCAGCACCAGCAGCAGGAGGG - Intergenic
1014010249 6:116467321-116467343 CAGCCCCAGCAGCAGCAGCCAGG + Intergenic
1014199094 6:118588999-118589021 CAACAGCAGCAGCGGCAGTGAGG - Intronic
1014592146 6:123286841-123286863 CAGCAGCAGCAGCAGCACCTGGG + Intronic
1014854392 6:126381659-126381681 TGTCAGCAGCAGCAGCAGTGCGG - Intergenic
1014947692 6:127516370-127516392 CTGCAGCAGCAGCAACAGCAGGG - Exonic
1015112221 6:129606126-129606148 CAGCAGAAGCAGCTGCTGTTAGG + Intronic
1015227080 6:130869922-130869944 CAGCAGCAGCAGTGAGAGTGAGG - Exonic
1015403055 6:132808691-132808713 CAGCAGGGGAAGCAGCAGAGAGG + Intergenic
1015773649 6:136792683-136792705 CAGCAGCAGCGGCAGCCGAAAGG + Intergenic
1015878916 6:137851454-137851476 CACCAGCAGCAGCAGCAGCTGGG + Intergenic
1016338854 6:143039090-143039112 CAGCAGAAGAAGCACCAGGGAGG - Intergenic
1016577298 6:145583976-145583998 CAGCAGAGGCAGCAACTGTGTGG + Intronic
1016988586 6:149913235-149913257 CATCAGCAGTAGCAGCCATGTGG - Intergenic
1016994384 6:149951413-149951435 CATCAGCAGCAGCAGCCATGTGG + Intergenic
1016997272 6:149969552-149969574 GAGCAGAAGCAGGTGCAGTGAGG - Intronic
1017001533 6:150000633-150000655 GAGCAGAAGCAGGTGCAGTGAGG + Intergenic
1017327082 6:153151983-153152005 CTGCAGCAGCAGCAGTACTCTGG - Intergenic
1017840905 6:158222295-158222317 CAGCAGCAGAAGCAGTCATGGGG - Intergenic
1017973097 6:159329915-159329937 CAGCAGTGGCAGCAGCAGTGAGG + Intergenic
1018029340 6:159829903-159829925 CATCTTCAGCAGCAGCAATGTGG + Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018758871 6:166872934-166872956 ACGCAGGAGCAGCAGCAGTCAGG + Intronic
1018934851 6:168267058-168267080 CCGCAGCAGCAGCAGCTGCTAGG - Intergenic
1019014146 6:168867534-168867556 CAGCAGGAGCAGGAGAGGTGAGG + Intergenic
1019032297 6:169024112-169024134 AATCAGCAGCAGAAGCAGAGGGG + Intergenic
1019178638 6:170174164-170174186 CAGAAGCAGCAGAAGCAGCTAGG - Intergenic
1019319376 7:408707-408729 CTGCAGCACCGGCAGCTGTGGGG + Intergenic
1019374847 7:683895-683917 CATCAGCTGCAGAAGAAGTGGGG - Intronic
1019401527 7:856821-856843 CAGGAGCAGCAGCAGAGATGAGG - Intronic
1019450640 7:1095943-1095965 CGGCAGCAGCGGCAGCGGGGAGG + Intronic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019484193 7:1281144-1281166 CAGCAGCAGCAGCAGCCAGGAGG + Intergenic
1019527688 7:1488046-1488068 CAGAGGCAGCAGCAGCCGTAGGG - Intronic
1019940553 7:4285883-4285905 CAGCAGTGGCAGCAGCAGGAAGG - Intergenic
1020049471 7:5072387-5072409 CAGCAGCAGCAGCAACAGCGGGG - Exonic
1020055982 7:5117750-5117772 TAGCACCAGCAGCAGCAGGCAGG - Intergenic
1020086436 7:5313153-5313175 CAGCAGCAGCAGCAGCGGCTCGG - Exonic
1020260776 7:6529676-6529698 CAGCAGAGCCAGGAGCAGTGGGG + Intronic
1020607761 7:10359981-10360003 CAGAAGCAGCAGTAGCATGGCGG + Intergenic
1020620584 7:10514255-10514277 CAGCAGTTCCAGCATCAGTGAGG + Intergenic
1020915802 7:14191135-14191157 CAGCACCAGCAGCAACAATCAGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021208521 7:17814076-17814098 TAGGAGCAGGAGGAGCAGTGGGG - Intronic
1021429412 7:20543185-20543207 CAGCAGCAGCAGCATCACCTTGG + Intergenic
1021561361 7:21971859-21971881 GAGCAGCAGCTGCAGCAGAGAGG - Intergenic
1021570149 7:22056915-22056937 CAGCAGCAGCAGCATCACCTGGG - Intergenic
1021769480 7:23984263-23984285 CACAAGCAGCAGCCCCAGTGGGG - Intergenic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1022334202 7:29407098-29407120 CATCAGGAGCAGCAGGAGTCTGG + Intronic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1022480195 7:30738612-30738634 CAGCAGCAGCAGCATCACCAGGG - Intronic
1022538214 7:31111369-31111391 TGGCAGCAGCAGTAGCAGTAAGG - Exonic
1023418304 7:39951436-39951458 CAGCAGCAGTAGCAGCCGCAAGG + Exonic
1023560620 7:41469962-41469984 CAACATAAGCAGCAGCAATGAGG + Intergenic
1024047496 7:45595229-45595251 CCACTGCATCAGCAGCAGTGGGG + Intronic
1024101504 7:46037128-46037150 CAGCAGCAGCAGCACCAACAGGG + Intergenic
1024293830 7:47827266-47827288 CAGGAGGACCAGCGGCAGTGGGG + Intronic
1024298292 7:47863675-47863697 TGGCAGGAGCAGCGGCAGTGTGG + Intronic
1024299531 7:47876569-47876591 CAGCAGGAGGAGCAGGAGGGAGG + Intronic
1024556473 7:50607419-50607441 CCACAGTAGCAGCAGCACTGAGG - Intronic
1024607946 7:51038278-51038300 CAGGTGCTGCAGCAGCAGCGAGG + Intronic
1024841486 7:53592194-53592216 CAGAAGCAGCTGGAGCATTGGGG - Intergenic
1024857161 7:53795074-53795096 CAGCTGCAGCAGCGGAGGTGTGG - Intergenic
1025014485 7:55427903-55427925 CAGCAGCAGCAGCTGTGGAGGGG + Intronic
1025207876 7:57003949-57003971 CAGCAGCAGCAGCAGTGGCTCGG + Intergenic
1025664064 7:63572914-63572936 CAGCAGCAGCAGCAGCGGCTCGG - Intergenic
1025813153 7:64888204-64888226 GGGCAGCAGCAGCAGCAGCCAGG - Intronic
1026173993 7:67979726-67979748 CAGCAGCAGGAGAAGCATGGAGG - Intergenic
1026402368 7:70027498-70027520 CAGCAGCAGCAGCATCACCTGGG + Intronic
1026734915 7:72943233-72943255 CAGCAGCGGGAGCAGCAGCTCGG + Exonic
1026764986 7:73154820-73154842 CAGCAGCAGCAGCAGCACCGGGG + Intergenic
1026785248 7:73298148-73298170 CAGCAGCGGGAGCAGCAGCTCGG + Intergenic
1026822176 7:73557255-73557277 CGGCAGCAGCCGCAGCAGGTGGG + Intronic
1026822177 7:73557258-73557280 CAGCAGCCGCAGCAGGTGGGCGG + Intronic
1026853479 7:73738659-73738681 CAGCAGCAGCGGCGGCCGAGGGG - Exonic
1027041458 7:74964575-74964597 CAACAGCAGCAACAGCACCGGGG + Intergenic
1027049147 7:75010636-75010658 CAGCCGCAGGTGCAGCACTGAGG + Intronic
1027082182 7:75237792-75237814 CAACAGCAGCAGCAGCACCGGGG - Intergenic
1027108826 7:75421776-75421798 CAGCAGCGGGAGCAGCAGCTCGG - Exonic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1027924935 7:84448001-84448023 CACCAGCTGCTGCAGCAGGGTGG - Intronic
1028132554 7:87193299-87193321 AAGCAGGAGCAGCAGCTGTCAGG - Exonic
1028259097 7:88639351-88639373 CAGCACCAGCAGCAACAATCAGG - Intergenic
1028270039 7:88777134-88777156 CAGTAGCACCAGCAGGACTGTGG - Intronic
1028640681 7:93039410-93039432 CAGCTGCAGCAGCACCTGGGAGG - Intergenic
1028774677 7:94663739-94663761 CAGCAGCTGCTGCAGCACCGCGG - Exonic
1028962545 7:96765491-96765513 GAGCAGCAGCAGCAGCAGCTGGG - Intergenic
1028963608 7:96776971-96776993 CAGAAGCAGTGGCAGCAGAGAGG + Intergenic
1029110943 7:98212769-98212791 CAGCAGCAGCAGCAGGTGGCTGG + Exonic
1029331410 7:99859255-99859277 CAGCAGCACCAGCAGCATCTGGG - Intronic
1029439032 7:100577300-100577322 CGGCGGCAGCAGCAGCAGAGCGG - Exonic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1030075457 7:105732859-105732881 CAGCAGGTGCAACAGCACTGAGG - Intronic
1030595218 7:111530046-111530068 CAGAAGCAGCATCAGCAAAGAGG + Intronic
1030769733 7:113459106-113459128 CAGCAAGAGAAGCAGCAATGTGG - Intergenic
1030861052 7:114629967-114629989 CAGCAGCAGCAACAGCATCCTGG + Exonic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1031702780 7:124945467-124945489 CAGCAGCAACAGTGGCAGTGTGG - Intergenic
1031870133 7:127082079-127082101 GAGCATCTGCAGGAGCAGTGTGG - Intronic
1031966642 7:128031972-128031994 CGGCGGCAGCAGCAGCAGCGGGG + Intronic
1032071750 7:128812144-128812166 CAGCAGCACCAGTGCCAGTGAGG + Exonic
1032609441 7:133396067-133396089 CAGCAGCATCAGCATCACTTAGG + Intronic
1032842891 7:135727848-135727870 GAGCAGCAGCAGCAAAGGTGTGG - Exonic
1032854590 7:135823914-135823936 CCACAGCAGCAGCATCAGTAGGG - Intergenic
1032863036 7:135899499-135899521 TACCAGCAGCTGCAGCAGTTAGG + Intergenic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033280924 7:140005901-140005923 CAGCAGCAGCAGCATCACCCGGG - Intronic
1033464512 7:141578597-141578619 CAGCAGGAGTAGGGGCAGTGTGG + Intronic
1033656174 7:143376144-143376166 CCGGATCAGAAGCAGCAGTGAGG - Intergenic
1033673015 7:143511272-143511294 CAGCAGCAGCAGCACCAGGCAGG + Intergenic
1033765693 7:144488052-144488074 CAGCAGCAGCAGCATCCCTGGGG + Intronic
1033791151 7:144793425-144793447 CAGCAGTGGCAGCAGCATTTTGG - Intronic
1034261958 7:149762860-149762882 CAGCAGCATCAGGAGCAGCTGGG - Intergenic
1034323014 7:150203104-150203126 CAGCAGCATCAGCATCATTTCGG + Intergenic
1034331530 7:150287352-150287374 CAGCAGCAGCAGCATCCTGGCGG - Intronic
1034331531 7:150287355-150287377 CAGCAGCAGCAGCAGCATCCTGG - Intronic
1034355724 7:150449569-150449591 CCGCAGAAGGAGGAGCAGTGGGG - Intergenic
1034366351 7:150551805-150551827 TAGCAGCAGCAGCAGAACAGTGG - Intergenic
1034417193 7:150971375-150971397 CAGCATCAGCTGTTGCAGTGGGG + Intronic
1034426346 7:151016201-151016223 CAGCAGCAGCAGGAGCCGTGGGG - Exonic
1034440035 7:151081666-151081688 CAGCAACAGCAGGAGCAGCAGGG + Exonic
1034454004 7:151155031-151155053 CAGCAGGAGCTGCAGTAATGGGG - Intronic
1034557230 7:151858010-151858032 CCACAGCACCACCAGCAGTGGGG - Intronic
1034595160 7:152182494-152182516 CAGCAGCAACAACAGCAATTTGG - Exonic
1034666513 7:152822509-152822531 CAGCAGCAGCAGCATCCTGGCGG + Intronic
1034770167 7:153766003-153766025 CAGCAGCATCAGCACCATTTGGG - Intergenic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1034989694 7:155540552-155540574 AAGCACCAACAGCAACAGTGAGG - Intergenic
1035057537 7:156046097-156046119 CAGGAGCAGGAGCAGGAGAGAGG + Intergenic
1035297474 7:157875663-157875685 CTGCAGCAGCAGCAGCACCTTGG + Intronic
1035686674 8:1528486-1528508 CACCAGGAGCAGCAGCAGCTAGG + Intronic
1036422127 8:8606854-8606876 CAGCAGCAGCAGCATCACCTGGG - Intergenic
1036579689 8:10062230-10062252 CAGCAGCAGCAGCAGCTGGCTGG + Intronic
1036760251 8:11503775-11503797 CAGCAGCCTCAGCAGAGGTGAGG - Intronic
1036946571 8:13100095-13100117 CAGCAGCAGCAGCAGCCAGTCGG - Exonic
1037143057 8:15540507-15540529 CAGCAGCAGCAGGAGAAGGAAGG - Exonic
1037150026 8:15626066-15626088 CAGGAGCAGCAGTGGCAGTGGGG + Intronic
1037155574 8:15694901-15694923 CGCCAGCAGCAGCAGCAGTCTGG + Intronic
1037538396 8:19848960-19848982 CAGCAGCAGCGGGTGCAGTGAGG + Intronic
1037627017 8:20617186-20617208 CAGCTGCAGCACCAGAAGTAAGG + Intergenic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1037885273 8:22592751-22592773 CAGCAGCATCCGCATCACTGGGG - Intronic
1038260558 8:25989834-25989856 CAGAAGCAACAGCAGCAGCAAGG + Intronic
1038379835 8:27082261-27082283 CTGCAACAGCAACAGGAGTGAGG + Intergenic
1038455440 8:27669545-27669567 CAGCAGCAGTGGCAGCAGCCTGG - Intronic
1039467982 8:37797303-37797325 CAGCGGCAGCAGCAGGCGCGCGG - Exonic
1039814261 8:41078851-41078873 CACCAGCAACAGGAGCACTGTGG - Intergenic
1040083858 8:43318509-43318531 CAGCAGCAGCACCATCAGTCAGG - Intergenic
1040446885 8:47504922-47504944 CAGCAGCAGACGCTGCAGAGTGG + Intronic
1040684472 8:49855622-49855644 CAGCAGTAACTGCAGCAATGAGG - Intergenic
1041167442 8:55103172-55103194 CAGCGGCAGCAACAGCAGCGGGG + Exonic
1041232546 8:55768395-55768417 CAGCTGCAGCAGCAGCAGCAAGG - Intronic
1041393298 8:57367049-57367071 CAGCGGGAGCAGAGGCAGTGTGG - Intergenic
1041694438 8:60720873-60720895 CATCAGCAGCAGCACCTGTGTGG + Intronic
1041698840 8:60765630-60765652 CAGCAGCAGCAGCCGCACAAAGG - Intronic
1041787046 8:61646947-61646969 CAGCAGCAGGAGCAGGTGTGTGG - Intronic
1041869370 8:62615821-62615843 CCCTGGCAGCAGCAGCAGTGTGG - Intronic
1041871900 8:62644207-62644229 TAGTAGCAGCAGGAGCAGTGAGG - Intronic
1042027870 8:64443264-64443286 CAGCAGAAGCAGCAGCACATGGG + Intergenic
1042444024 8:68862548-68862570 CGGCAGCAGCAGCAGCAGGTGGG - Intergenic
1042573005 8:70187126-70187148 AGGCAGCAGGAGAAGCAGTGAGG + Intronic
1042764745 8:72308755-72308777 CATTCACAGCAGCAGCAGTGGGG + Intergenic
1042764747 8:72308761-72308783 CAGCAGCAGCAGTGGGGGTGTGG + Intergenic
1042915868 8:73875581-73875603 CAGCAGCAGCAGCAACATCCTGG + Intronic
1043131810 8:76472188-76472210 CAGCAGCAGCAGTAGCATGCAGG + Intergenic
1043364770 8:79520224-79520246 CAGCAGCAACAGTACAAGTGAGG + Intergenic
1043519426 8:81027989-81028011 CAGCCCCAACAGCAGCTGTGGGG - Intronic
1043982094 8:86655043-86655065 AAGCAGGAGGAGCAGCAGTTTGG - Intronic
1044068311 8:87724524-87724546 CAGCAGCATCAGCACCACTTGGG - Intergenic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1044313883 8:90727063-90727085 CAGCAGCGGCAGCAGCAGCATGG - Intronic
1044407122 8:91840402-91840424 CAGCAGCATCAGCATCATTTGGG - Intergenic
1044900700 8:96941174-96941196 CAGCAGCAGCAGCAGCACCAGGG - Intronic
1044923075 8:97186117-97186139 CTACAGCAGCAGCAGCAACGTGG + Intergenic
1044927899 8:97224691-97224713 CTGCAGAAGCAGCGGCAGAGGGG - Intergenic
1045183430 8:99811525-99811547 CAGCAGCATCAGCAGCACCTGGG - Intronic
1045398855 8:101790916-101790938 CAGCAGTAGCAGCAGCAGCAAGG + Intronic
1045438700 8:102189175-102189197 CAGCAGCATCAGCATCACCGTGG - Intergenic
1045499398 8:102733431-102733453 CAGCAGCAGGAGCAGCAGCATGG + Intergenic
1045705478 8:104917519-104917541 CAACAGCAACAGCACAAGTGGGG + Intronic
1045716541 8:105053734-105053756 AAGTAGCAGCAGCAGCAGATAGG - Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1045718320 8:105074908-105074930 CAGCAGCAGCAGCAGCGGGAGGG - Intronic
1045824926 8:106386071-106386093 GGGCAGCAGCAGCAGCAGCAAGG + Intronic
1045852904 8:106724535-106724557 CATCAGCAGCAGCAGCACCTGGG + Intronic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1046078798 8:109344705-109344727 CAGCAGCATGAGCACCAGTTGGG - Exonic
1047021348 8:120777930-120777952 CAGCAGCAGCAGAAACACTTTGG + Intronic
1047251503 8:123184711-123184733 CCTCTGCAGCAGCAGGAGTGAGG - Intronic
1047316657 8:123741030-123741052 TACCAGCAACAGCAGCAGTGGGG + Intergenic
1047343971 8:124009594-124009616 CAGCAGCACCAGCTCCTGTGTGG - Intronic
1047418935 8:124690144-124690166 CGGCGGGAGCAGCAGCAGTGGGG - Intronic
1047493071 8:125390222-125390244 CAGCGGCAGCAGCAGCGTGGGGG - Intergenic
1047493074 8:125390225-125390247 TGGCAGCGGCAGCAGCAGCGTGG - Intergenic
1047611675 8:126526981-126527003 AAGAAGCAGAGGCAGCAGTGGGG - Intergenic
1047645527 8:126866118-126866140 CAGCAGCATCAGCATCAGCTGGG - Intergenic
1047836914 8:128703804-128703826 CTGCAGCAGCAGCAGCAACTTGG - Intergenic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048265461 8:132981641-132981663 CAGCAGCAACAGCAGCGCTGGGG + Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048472925 8:134719441-134719463 GCCCAGCAGCAGCAGCAGCGAGG + Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048765329 8:137837545-137837567 AAGCAGCAGCAGCAGCAGTTTGG + Intergenic
1048827481 8:138443002-138443024 CAGTAGCAGCAGCCTCACTGGGG - Intronic
1048912871 8:139152854-139152876 CAGAAACAGCAGCAGCACAGAGG - Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1049030278 8:140031194-140031216 CATCAGAAGAAACAGCAGTGAGG + Intronic
1049095733 8:140547126-140547148 CAGCAGCAGCAGCTACCGTGTGG - Intronic
1049171946 8:141166981-141167003 CAGCAGCAGCAGGTGCCCTGGGG - Intronic
1049214964 8:141403293-141403315 CAGCATCAGCAACACCAGGGAGG - Intronic
1049280043 8:141739698-141739720 GGGCAGGAGCAGCAGCAGTCAGG - Intergenic
1049345800 8:142137921-142137943 CGTAAGCAGCAGCAGCAGTAGGG - Intergenic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1049478579 8:142808232-142808254 CAGCAGCAGCAGCAGTGGGCTGG + Intergenic
1049587856 8:143440290-143440312 CAGCCACGGCAGCCGCAGTGAGG + Exonic
1049628489 8:143637475-143637497 CAGCAGCCACAGCAGCTCTGGGG - Intronic
1049713332 8:144077426-144077448 CAGCTGCAGCAGCAGGGTTGTGG + Intergenic
1049791082 8:144473032-144473054 CACCTGCAGCAGCAGCACCGCGG - Exonic
1049802581 8:144524936-144524958 CAGCAGCAGCGGCAGCAGTGCGG + Exonic
1049812307 8:144580958-144580980 CGGCAGCAGCGTCAGCCGTGAGG - Exonic
1049914772 9:306750-306772 CAGCAGCATCAGCATCACTTAGG - Intronic
1049923773 9:389605-389627 CAGCAGCAGCAGCAGCACCCAGG + Intronic
1050052773 9:1620547-1620569 CAGCAGCAGCAGCAGCTGTTTGG + Intergenic
1050182230 9:2934007-2934029 CAGCTGCAGCCGCTGCAGGGTGG + Intergenic
1050247268 9:3703738-3703760 CAGCAGCATCAGCACCACTTGGG + Intergenic
1050363793 9:4855471-4855493 CCACAGCAGCAGCTGCACTGAGG - Intronic
1050702741 9:8359217-8359239 CAGCAGCATCAGCAGCATGTAGG + Intronic
1050733242 9:8733808-8733830 GAGGAGCAGCAGCAGCAGCCTGG + Exonic
1050928471 9:11296460-11296482 TAGCAGCAGCAACAGCAGCACGG + Intergenic
1050928472 9:11296463-11296485 CAGCAGCAACAGCAGCACGGTGG + Intergenic
1051145763 9:14025819-14025841 CCACAGCAGCAGAAGAAGTGTGG + Intergenic
1051220394 9:14842701-14842723 GTGCAGAAGCAGCAGCTGTGGGG + Intronic
1051222870 9:14868924-14868946 CAGGAGGAGCAGCAGCAGCACGG + Exonic
1051253346 9:15185503-15185525 CAGCAGCAGCAGCATCACCTGGG + Intronic
1051266699 9:15316166-15316188 CAGCAGCAGCAGCAGCAAGTGGG - Intergenic
1051677341 9:19571559-19571581 CAACAGCATCAGCATCACTGGGG + Intronic
1051774894 9:20622463-20622485 CAGCAGCAGCAGCAGCTCCAGGG + Exonic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1052090481 9:24320920-24320942 CAGCTGGAGCTGGAGCAGTGGGG + Intergenic
1052437223 9:28444375-28444397 ATGCAACAGAAGCAGCAGTGGGG + Intronic
1052689159 9:31793521-31793543 TAGCAGTAGCAGCAGCAGTAAGG + Intergenic
1052799281 9:32952667-32952689 CAGCTGGAGCAGGAGCAGGGTGG + Intergenic
1053020930 9:34693453-34693475 CAGCAGCAGCAGCATCACTTGGG + Intergenic
1053053113 9:34977585-34977607 CAGCAGCAGCAGCAAGAGTCAGG + Exonic
1053119940 9:35538884-35538906 CAGCAGCCGCGGCAGCAGCACGG + Exonic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1053399993 9:37810411-37810433 CAAAAGCAGCAGCAGCAATGAGG + Intronic
1053511271 9:38689739-38689761 CGGCAGCAGCAGCAACAGCAGGG - Intergenic
1053530898 9:38879681-38879703 CAGCAGTGGCAGTGGCAGTGTGG - Intergenic
1053542847 9:38993161-38993183 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053807293 9:41816678-41816700 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1054203121 9:62104114-62104136 CAGCAGTGGCAGTGGCAGTGTGG - Intergenic
1054447666 9:65385470-65385492 CAGCGGCAGCAGGAGCATCGCGG + Intergenic
1054623299 9:67370749-67370771 CAGCAGCAGCAGTGGCAGCGAGG - Intergenic
1054635242 9:67484251-67484273 CAGCAGTGGCAGTGGCAGTGTGG + Intergenic
1054716635 9:68563535-68563557 CGGCAGCAGCAGCATCAGCTGGG + Intergenic
1054782032 9:69174313-69174335 CAGGAGCAGAAGCAGAAGCGGGG + Intronic
1054790418 9:69251437-69251459 CATCTGCAGCAGCAGCAAAGGGG - Intronic
1055231761 9:74074812-74074834 CACCAACAGCTGCAGCAGTGTGG + Intergenic
1055278124 9:74642494-74642516 GAACAGCGGCAGCAGCAGAGTGG + Exonic
1055391506 9:75826775-75826797 CAGCAGCATCAGTAGCAAGGAGG + Intergenic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1055868199 9:80841327-80841349 CAGCAGCATCAGCATCACTTCGG + Intergenic
1056180198 9:84075622-84075644 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
1056322694 9:85451901-85451923 AAGCATCAGCTGCAGTAGTGTGG + Intergenic
1056364253 9:85887242-85887264 CAGCAGCATCAGCAGCATCTGGG - Intergenic
1056456533 9:86766163-86766185 CAGCAGCAGCTGCAGGAGGAGGG + Intergenic
1056845878 9:90037688-90037710 CAGCAGCAGCAGGAAGAATGAGG - Intergenic
1057043177 9:91862360-91862382 GAGCAGCAGGAGCAGCAGCCAGG + Intronic
1057492192 9:95529064-95529086 CAGCAGCAGCAGCCTCACTTGGG + Intergenic
1058000171 9:99856830-99856852 CAGCAGCATCAGCATCACTGGGG - Intronic
1058497410 9:105574593-105574615 CAGCAGCACCAGCATCATTTGGG + Intronic
1058732086 9:107860109-107860131 CACCAGCATCACCAGCAGAGAGG + Intergenic
1059249633 9:112877114-112877136 CAGCAGCAGCAGCATCACCTGGG - Intronic
1059288371 9:113198128-113198150 CAGCAGCAGGAGGAGCACTGGGG - Intronic
1059386645 9:113969775-113969797 CAGCAACAGCAGCGGCAGCATGG - Intronic
1059473987 9:114529139-114529161 CAGAAGCAGAGGGAGCAGTGGGG + Intergenic
1060040335 9:120294841-120294863 CATCAACAGCAGCAGCATTCTGG + Intergenic
1060411629 9:123404163-123404185 CCGCTGCTGCAGCAGCTGTGGGG - Intronic
1060531585 9:124350099-124350121 CAGCAGCAGCAGCAGGAAGCTGG - Intronic
1060552335 9:124491524-124491546 CAGCAGCACCAGCAGCTCAGGGG + Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060745444 9:126127904-126127926 CAGCAGGAGAAGGAGGAGTGAGG + Intergenic
1060986859 9:127825071-127825093 CAGAAGACGCAGCAGGAGTGGGG - Intronic
1061089959 9:128420894-128420916 CAGCAGCTGGAGCAGCGGCGCGG - Exonic
1061413164 9:130431869-130431891 TACCAGCAGCAGCAGCTGTGCGG - Intronic
1061506974 9:131036948-131036970 CAGCAGCACCAGCACCAGCTGGG - Intronic
1061527165 9:131175574-131175596 CAGCTGCCGCAGCAGCACTCAGG + Exonic
1061633844 9:131892698-131892720 CAGCAGGAGAGGCAGCACTGAGG - Intronic
1061835247 9:133324289-133324311 CAGCAGGGGAAGCAGCGGTGGGG + Intergenic
1062084618 9:134642237-134642259 CAGCAGCGGGGGCAGCAGCGGGG - Exonic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062145044 9:134984461-134984483 CAGCAGCAGCAGGAGCCCTGTGG - Intergenic
1062372185 9:136245693-136245715 TAGCAGCCGCGGCAGCCGTGCGG + Exonic
1062402933 9:136380334-136380356 GAGGAGCAGGAACAGCAGTGGGG - Intronic
1062403702 9:136383536-136383558 CAGCAGCAGCAGCAGCGAGGAGG - Exonic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062467394 9:136687313-136687335 CAGCAGCAACAGCAGCGCCGCGG + Exonic
1203529251 Un_GL000213v1:122773-122795 CAGCAGCAAGAGCAGGAGCGAGG + Intergenic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1186495283 X:10008111-10008133 CAGCAGCGGCAGCATCACGGGGG - Intergenic
1186536574 X:10356091-10356113 CAACAGTAGCAACAGAAGTGAGG + Intergenic
1186750261 X:12614415-12614437 CAGCAGCATCAGCAGCACCTGGG + Intronic
1186758728 X:12700935-12700957 CAGCCACAGCAGCTGCAGGGAGG - Intronic
1186880084 X:13856382-13856404 CAGCAGCAGCAGCAGCATCTGGG + Intronic
1187274851 X:17808232-17808254 CAGCAGCAGCAGCAGCACCCAGG + Intronic
1187537394 X:20155262-20155284 CAGCAGGAACAGCAGCATTATGG + Exonic
1187562468 X:20415524-20415546 CTGCAGCATCAGCATCACTGGGG + Intergenic
1187629458 X:21152841-21152863 CAGCAGCATCAGCATCACTTGGG - Intergenic
1187708926 X:22034725-22034747 CAGCAGCATTAGCATCACTGGGG + Intronic
1188323440 X:28769767-28769789 GAGCAGATGCAGCAGCAGTAGGG - Intronic
1188437121 X:30173694-30173716 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1188707882 X:33357715-33357737 CAGCAGCAGCAGTAGCAGTATGG - Intergenic
1188833908 X:34933164-34933186 CAGCAGCAGTGGTGGCAGTGAGG - Intergenic
1188833923 X:34933242-34933264 TGCCAGCAGCAGCAGCAGTGTGG - Intergenic
1188835456 X:34948706-34948728 CAGCTGCTGCAGCAGCATTGCGG - Intergenic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189211929 X:39290980-39291002 CAGCAGCATCAGCAGCAGCTGGG - Intergenic
1189219428 X:39358465-39358487 CAGCAGCATCAGCATCACTTGGG - Intergenic
1189247537 X:39575389-39575411 AGGCAGAGGCAGCAGCAGTGAGG - Intergenic
1189248554 X:39582025-39582047 GAGCAGGAGCAGCAACAGGGTGG + Intergenic
1189318570 X:40073500-40073522 CAGTAGCAGCACCAGCAGCAAGG - Exonic
1189550346 X:42086169-42086191 GAGCAGCAGCAGGAAAAGTGTGG - Intergenic
1189558046 X:42165715-42165737 CAGCAGTGGCAGCAGCAGCACGG + Intergenic
1189558047 X:42165718-42165740 CAGTGGCAGCAGCAGCACGGTGG + Intergenic
1189647939 X:43154495-43154517 CAGCAGCATCAGCATCACTTGGG - Intergenic
1189926468 X:45960095-45960117 CAGTAACAGCAGCAGGGGTGGGG - Intergenic
1189959200 X:46308303-46308325 GAGCAGCAGGAGCAGCAGCTAGG - Intergenic
1189992818 X:46610626-46610648 CAGCAGCAGCAGCAGGACCGAGG + Intronic
1190028151 X:46945493-46945515 CAGTGGTAGCAGCAGCACTGGGG - Intronic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190287696 X:48971755-48971777 CAGGAGCAGCAACAGCGGTGGGG + Intergenic
1190459504 X:50658259-50658281 CACCAGCACCAGCAGAAGAGTGG - Intronic
1190729164 X:53213544-53213566 GAGCAGCTGAAGCAGCAGTAAGG - Intronic
1190745082 X:53317715-53317737 CAGCAGAGGCTGCAGCATTGGGG - Intronic
1190887076 X:54539716-54539738 CAGCAGTAGCAGCAGCACCTGGG - Intronic
1190892902 X:54586652-54586674 AGGCAGCAGCAGCTGCACTGTGG - Intergenic
1191128186 X:56980618-56980640 GGGCAGCAGCAGTAGCAGCGTGG + Intronic
1191225741 X:58040910-58040932 CAGCAACAGTAGCAGCATGGTGG - Intergenic
1191642436 X:63441868-63441890 TAGCAGCAGCTGCAGCAGTGTGG - Intergenic
1191695552 X:63986079-63986101 TAGCAGCAGCAGTGGCAGTGTGG - Intergenic
1191840849 X:65512834-65512856 CAGCAGCAGCAGCAACTTCGAGG - Exonic
1192034132 X:67545399-67545421 AGGCAGCAGCAGCAGCAGCAGGG + Exonic
1192232828 X:69277837-69277859 CAGCAGCAGCAGCAACTTTGGGG + Intergenic
1192982945 X:76366753-76366775 TGCCAGCAGCAGCAACAGTGAGG + Intergenic
1193168401 X:78307768-78307790 GAGTGGCAGCAGCAGAAGTGTGG + Intronic
1193374015 X:80736034-80736056 CATCAGCACCAGTAGAAGTGAGG + Exonic
1193467985 X:81869694-81869716 CAAAAGCAGCAGTGGCAGTGAGG - Intergenic
1193736214 X:85159838-85159860 CAGCAGCAGCAGTGGCAGCATGG - Intergenic
1193821603 X:86171698-86171720 CAGCAGCAACAGCAGCATGTGGG - Intronic
1193894684 X:87098673-87098695 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1194081023 X:89465419-89465441 CACCAGCTGCAGCAGTAGTGGGG - Intergenic
1194085683 X:89524957-89524979 TGCCAGCAGCTGCAGCAGTGTGG + Intergenic
1194348171 X:92792812-92792834 CACCGCCAACAGCAGCAGTGCGG + Intergenic
1194353299 X:92849654-92849676 CAGCTGCAGAAGCAGTAGGGAGG - Intergenic
1194425393 X:93731340-93731362 CAGCAGCAGCAGCAGCACCCTGG - Intergenic
1194542885 X:95196555-95196577 CAGAAGCAGCGGCAGCATGGTGG + Intergenic
1195289014 X:103413861-103413883 TAGCAGCTGCAGCTGCACTGTGG + Intergenic
1195533237 X:105981991-105982013 CAGCAGCAACAGCAGCACGACGG + Intergenic
1195544491 X:106100104-106100126 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1195687988 X:107602686-107602708 CTGCAGCAGCAGCAGCCCTGAGG + Exonic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196117576 X:112014128-112014150 CAGCAGCACCAGCAGCACCTGGG - Intronic
1196187483 X:112760146-112760168 AAAAAGCAGCAGCAGCAGTCTGG - Intergenic
1196193255 X:112815539-112815561 CAGCAGCCACAGCAGCAGCCAGG - Exonic
1196473688 X:116058404-116058426 TAGCAGCAGCATCAGTAGTATGG + Intergenic
1196723316 X:118875001-118875023 CGCAAGCAGCAGCAGAAGTGAGG + Intergenic
1196893838 X:120313988-120314010 TAGCAGCAGCTGCAGCAGCTTGG + Intergenic
1197055487 X:122113767-122113789 CTGCAGCTGCAGCTGCTGTGGGG + Intergenic
1197104996 X:122703134-122703156 TAGCAGCAGCAGCAGCAGGCAGG + Intergenic
1197141558 X:123122464-123122486 CAGCAGCAGCAGCAGCTTGGTGG - Intergenic
1197773597 X:130106202-130106224 CAGCAGCAGCTGGAGGAGGGAGG - Intronic
1197855914 X:130913742-130913764 TAGCAGCAGCAGCAGTAATCAGG - Intergenic
1198044944 X:132892325-132892347 CAGTAGCAGCAGCAGCACCTTGG + Intronic
1198451161 X:136767918-136767940 CGGCAGCAGCATGCGCAGTGTGG - Intronic
1198502647 X:137267315-137267337 CAGCAGCATCAGCATCAGCTGGG - Intergenic
1198737284 X:139800594-139800616 CAGCAGCAGCAGCATTACTGGGG - Intronic
1198987840 X:142476710-142476732 ATGCAGCACCACCAGCAGTGTGG - Intergenic
1199089261 X:143671933-143671955 CAGCAGTGGCAGGAGCAATGTGG + Intergenic
1199146890 X:144379402-144379424 CAGCAGTGGCAGCATCATTGTGG + Intergenic
1199358191 X:146885864-146885886 GACCCCCAGCAGCAGCAGTGTGG + Intergenic
1199612713 X:149631682-149631704 CAGTAGCGGGAGCAGCAGCGTGG - Exonic
1199681250 X:150225960-150225982 CAGCAGCGGCAGCATTAGGGAGG + Intergenic
1199988150 X:152967161-152967183 CTGCAGCGTCAGCAGCATTGAGG + Exonic
1200110073 X:153736541-153736563 CTGCAGCAGCAGCAGGGGCGGGG - Intronic
1200110078 X:153736547-153736569 CAGCACCTGCAGCAGCAGCAGGG - Intronic
1200433695 Y:3121622-3121644 CACCAGCTGCAGCAGTAGTGGGG - Intergenic
1200438329 Y:3180840-3180862 TGCCAGCAGCTGCAGCAGTGTGG + Intergenic
1200656500 Y:5909441-5909463 CACCGCCAACAGCAGCAGTGTGG + Intergenic
1200661657 Y:5966727-5966749 CAGCTGCAGAAGCAGTAGGGAGG - Intergenic
1201229125 Y:11845973-11845995 CAGAAGCAGCAGTGGCAGTATGG - Intergenic
1201300196 Y:12498566-12498588 CAGCAGCAGGAGCGGCAGGGAGG - Intergenic
1202044808 Y:20727317-20727339 CAGACGCAGCAGCAGAAGTTCGG + Intergenic