ID: 1065880341

View in Genome Browser
Species Human (GRCh38)
Location 10:30032047-30032069
Sequence TTAAAAATACAGATGGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2320
Summary {0: 2, 1: 1, 2: 11, 3: 162, 4: 2144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065880341_1065880344 -8 Left 1065880341 10:30032047-30032069 CCCGGCTCCATCTGTATTTTTAA 0: 2
1: 1
2: 11
3: 162
4: 2144
Right 1065880344 10:30032062-30032084 ATTTTTAACAAGCATTTCAGAGG No data
1065880341_1065880346 13 Left 1065880341 10:30032047-30032069 CCCGGCTCCATCTGTATTTTTAA 0: 2
1: 1
2: 11
3: 162
4: 2144
Right 1065880346 10:30032083-30032105 GGATTCTTATCCTCAATTTTGGG No data
1065880341_1065880345 12 Left 1065880341 10:30032047-30032069 CCCGGCTCCATCTGTATTTTTAA 0: 2
1: 1
2: 11
3: 162
4: 2144
Right 1065880345 10:30032082-30032104 AGGATTCTTATCCTCAATTTTGG No data
1065880341_1065880348 26 Left 1065880341 10:30032047-30032069 CCCGGCTCCATCTGTATTTTTAA 0: 2
1: 1
2: 11
3: 162
4: 2144
Right 1065880348 10:30032096-30032118 CAATTTTGGGAAACACTGCTAGG No data
1065880341_1065880349 27 Left 1065880341 10:30032047-30032069 CCCGGCTCCATCTGTATTTTTAA 0: 2
1: 1
2: 11
3: 162
4: 2144
Right 1065880349 10:30032097-30032119 AATTTTGGGAAACACTGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065880341 Original CRISPR TTAAAAATACAGATGGAGCC GGG (reversed) Intronic
Too many off-targets to display for this crispr