ID: 1065880416

View in Genome Browser
Species Human (GRCh38)
Location 10:30032788-30032810
Sequence CTGTTTGTGCTACAAGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065880416_1065880419 13 Left 1065880416 10:30032788-30032810 CCTGACACTTGTAGCACAAACAG 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1065880419 10:30032824-30032846 CACGGTGGTTGCTGTGTGCTAGG No data
1065880416_1065880418 -2 Left 1065880416 10:30032788-30032810 CCTGACACTTGTAGCACAAACAG 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1065880418 10:30032809-30032831 AGCAGCAGCTGCTTACACGGTGG No data
1065880416_1065880417 -5 Left 1065880416 10:30032788-30032810 CCTGACACTTGTAGCACAAACAG 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1065880417 10:30032806-30032828 AACAGCAGCAGCTGCTTACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065880416 Original CRISPR CTGTTTGTGCTACAAGTGTC AGG (reversed) Intronic
903887231 1:26547565-26547587 CTGTTGATGCTAGAAGAGTCTGG + Intronic
909873141 1:80769213-80769235 CTGTTGGTGCTATAAGTTTGGGG + Intergenic
911945884 1:104108342-104108364 CTGTTGGTTTTATAAGTGTCTGG + Intergenic
912328549 1:108794471-108794493 CTGATGGTTTTACAAGTGTCTGG - Intronic
913687334 1:121245012-121245034 CTGTGTGTCCAACAAGGGTCAGG - Intronic
914039196 1:144032657-144032679 CTGTGTGTCCAACAAGGGTCAGG - Intergenic
914150262 1:145035279-145035301 CTGTGTGTCCAACAAGGGTCAGG + Intronic
920474663 1:206263532-206263554 CTGTGTGTCCAACAAGGGTCAGG - Intronic
921044487 1:211464677-211464699 TTGTTTTTGCTGCAAGTGTTTGG + Intergenic
923026563 1:230209154-230209176 CTGTATGGGCTACAAGGCTCAGG - Intronic
1064618481 10:17189847-17189869 CTGTTTGTGCTAAAAGACTCTGG + Intronic
1065471092 10:26081799-26081821 CTGTTTGTGGGAGAAGTTTCTGG - Intronic
1065880416 10:30032788-30032810 CTGTTTGTGCTACAAGTGTCAGG - Intronic
1068270302 10:54715361-54715383 CTGTTTCTGCAACAAGTGCATGG - Intronic
1071402335 10:85286061-85286083 CTGTTTTAGCTACAATAGTCTGG + Intergenic
1073751286 10:106530005-106530027 ATTTTTGTCCTTCAAGTGTCTGG + Intergenic
1075531596 10:123234751-123234773 CTGATTGTCCTTCAAATGTCAGG + Intergenic
1076426109 10:130368764-130368786 CTGTCTGTGCTACTCGTGCCGGG + Intergenic
1082570975 11:54739814-54739836 CTGATGGTTTTACAAGTGTCTGG + Intergenic
1085618060 11:78016930-78016952 CAGTTTTTGCTGCAAGTGCCGGG - Exonic
1086900480 11:92361845-92361867 CTGTTTGTGTCACTAGTGCCTGG - Intronic
1087808359 11:102581200-102581222 CTCTTGGTGCTACATGTGCCAGG - Intronic
1089453703 11:118613570-118613592 CTGTTTGTGCTTACAGTGGCAGG + Intronic
1090681826 11:129067793-129067815 CTGTTTCTGCTCCAGTTGTCTGG - Intronic
1095130247 12:38533482-38533504 CTCTTTGTTCCACAAGTTTCAGG + Intergenic
1095576343 12:43744399-43744421 CTGATGGTTTTACAAGTGTCTGG + Intronic
1106385357 13:29279722-29279744 CTGTTTGAAGTACAAGTATCAGG - Intronic
1106804292 13:33290257-33290279 ATGTTTGAGATACAAGTGGCAGG + Intronic
1106906841 13:34418529-34418551 CCATTTGTGCTGCAAGTGTGGGG + Intergenic
1107379791 13:39844893-39844915 CTGTGTGTGCTACAATAGTGAGG - Intergenic
1108816831 13:54302919-54302941 CTGTTTGTGCTATATATTTCTGG - Intergenic
1108870260 13:54976002-54976024 CTGTTTGTTCCAAAGGTGTCAGG - Intergenic
1110600406 13:77366009-77366031 TTCTTTGTGCTACAAGTGTATGG - Intergenic
1112334547 13:98503194-98503216 CTGAATGTGCTACAAGTGTGCGG - Intronic
1113662314 13:112116086-112116108 GTGTTTGTCCTCCAAATGTCTGG - Intergenic
1114167966 14:20241536-20241558 CTGGTTCTGCCACTAGTGTCTGG + Intergenic
1114940344 14:27602101-27602123 CTTTTTGTGTTATAAGTGTCTGG + Intergenic
1120075820 14:80157173-80157195 GTGTTAGTGCTTCCAGTGTCTGG - Intergenic
1123857446 15:24427340-24427362 CTGTTTGTTCTTCAAACGTCAGG + Intergenic
1126275370 15:46872750-46872772 CTGTTTGTTCAACAGTTGTCAGG - Intergenic
1129880407 15:79003028-79003050 CTGACTGTTCTAAAAGTGTCAGG - Intronic
1134349372 16:13422266-13422288 CTGTCCTTGCTACAAGTGTCAGG + Intergenic
1149509462 17:57227092-57227114 CTGTTTGTTCTACCAGTTACTGG + Intergenic
1153069590 18:1089796-1089818 CTGTTTGTGGGAGAAGTTTCCGG - Intergenic
1153113371 18:1621697-1621719 CTGTTTGTACTATAAATTTCTGG - Intergenic
1154108457 18:11545806-11545828 CTGTTTCTGGTCCAAGTGTCTGG - Intergenic
1154194483 18:12255307-12255329 CTGTGTGTGCTACGTGTGGCGGG + Intronic
1159469213 18:68828064-68828086 CTGTTTTTGCTTCATGTGTTTGG - Intronic
1166537895 19:43586710-43586732 ATGTTTGAGCTCCATGTGTCAGG + Exonic
925573724 2:5338255-5338277 CTGTTTGTTTTAAAAGTGTGTGG - Intergenic
927553137 2:24016183-24016205 CTGTTTGGGGGAAAAGTGTCTGG + Exonic
933392427 2:81688213-81688235 CTGTTCATGCTATAAGTGACAGG - Intergenic
935320710 2:101886323-101886345 CTGTATGTGCTACAACAGCCTGG - Intronic
937889352 2:126925358-126925380 CTGATGGTTTTACAAGTGTCTGG + Intergenic
940818139 2:158319343-158319365 CTGTTTCTCCAACAAGTGTTTGG + Intronic
941037277 2:160582133-160582155 TAGTTTGTGCTACAAGGGTCTGG + Intergenic
944115516 2:196181919-196181941 CTGTTTGAGCTGCTAGTGCCTGG + Intergenic
945437285 2:209833527-209833549 CTGTCTTTGGTAGAAGTGTCTGG + Intronic
948066577 2:235085555-235085577 CTGTTGGTTTTATAAGTGTCTGG + Intergenic
949035237 2:241813140-241813162 CTGTTTGGGCCTCAGGTGTCGGG + Intronic
1172133766 20:32673593-32673615 CTGTCTGTGCTGAAAGTGTGGGG - Intergenic
1172983948 20:38967614-38967636 CTGTTTGAGCTAAAACTGTATGG + Intronic
1176951659 21:15054769-15054791 CTGTTGGTCCTGTAAGTGTCTGG - Intronic
1176964693 21:15198770-15198792 CTGTTTGGGGTACAAGTGACAGG + Intergenic
1177222796 21:18216806-18216828 CTGGTTGTGTGATAAGTGTCTGG - Intronic
1178767305 21:35466494-35466516 CTGGTTGTTATACAAGTGTGTGG + Intronic
1181724694 22:24803820-24803842 CTGTTTGTTTAACAAGTGTGTGG - Intergenic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
954364643 3:50139468-50139490 CTGTCTGTGCTCCAGGTGTTAGG - Intergenic
956884245 3:73542964-73542986 CTGTGTGTACTCCAAGTGTCTGG + Intronic
958838903 3:99179237-99179259 CTGTTGGTTTTATAAGTGTCTGG - Intergenic
959005157 3:101011689-101011711 CTTATGGTGCTTCAAGTGTCAGG - Intergenic
963504539 3:146167026-146167048 CTGTAAGTGCTAGGAGTGTCTGG + Intergenic
971104832 4:23513133-23513155 AAGATTGTGCTACATGTGTCTGG - Intergenic
971928889 4:33052281-33052303 CTGTTTGTGCTAAGAGAGTGAGG - Intergenic
974725984 4:65799082-65799104 CTGTTTGTGGTTAAAGTGTCAGG - Intergenic
979002018 4:115233542-115233564 CTGTTTTTACTCCAAGGGTCAGG + Intergenic
990458604 5:56013047-56013069 ATGTTTGTGCCTCGAGTGTCTGG + Intergenic
992249609 5:74864785-74864807 TTGTTTGCGCTTCAAGTGTTAGG + Intronic
993704541 5:91154796-91154818 CTGATGGTTTTACAAGTGTCTGG - Intronic
995739280 5:115337790-115337812 CCCTTTGTCCTACATGTGTCTGG + Intergenic
997099866 5:130957259-130957281 CTGGTTGTTTGACAAGTGTCTGG + Intergenic
997353196 5:133245365-133245387 ATGTGTGTGCTGCAAGAGTCTGG - Intronic
997591559 5:135076271-135076293 CTGTTTGTGCAAATACTGTCAGG - Intronic
997735305 5:136208655-136208677 TTGTCTGTCCTACCAGTGTCTGG + Intergenic
998682745 5:144488347-144488369 CTGTTTGTTCTTCACGCGTCTGG + Intergenic
998720491 5:144941467-144941489 CTGTTTGTCCTAGAAATGTAAGG - Intergenic
1004282650 6:14294016-14294038 CTTTCTGTGTTACAGGTGTCAGG - Intergenic
1004515998 6:16322785-16322807 CTGTGTTTGCCACAAGTGACAGG - Intronic
1007520835 6:42451182-42451204 CTGTTTCTGCAACAAGTGCATGG + Exonic
1008655030 6:53603216-53603238 TTTTTTTTGCTACAATTGTCAGG + Intronic
1008662296 6:53680713-53680735 ATGATTGTGCAAGAAGTGTCAGG - Intergenic
1011931001 6:92712869-92712891 TTGTTTATCCTACAACTGTCAGG - Intergenic
1015309263 6:131748037-131748059 CTGATTGTTTTATAAGTGTCTGG - Intergenic
1018630081 6:165814868-165814890 CTGCTTGTGCCTCAAGAGTCTGG + Intronic
1023845317 7:44116995-44117017 AGGTTTGTGCTACTGGTGTCCGG - Exonic
1024377376 7:48655331-48655353 CTTTTTATGTTACAAGTGTGTGG + Intergenic
1026513462 7:71046814-71046836 CTGTTTATGCAAGAATTGTCAGG + Intergenic
1026642608 7:72140459-72140481 CTGCGTGTGCTAAAATTGTCTGG - Intronic
1035407778 7:158611025-158611047 CTGTTTCTGTTACAGCTGTCAGG - Intergenic
1038909823 8:31950474-31950496 CTGTTTGTTTGACTAGTGTCTGG - Intronic
1039206305 8:35159381-35159403 CTGATGGTTTTACAAGTGTCTGG - Intergenic
1042029860 8:64464145-64464167 CTGATGGTTTTACAAGTGTCTGG + Intergenic
1044275685 8:90297060-90297082 CTGTTGGTTTTATAAGTGTCTGG - Intergenic
1047212536 8:122851452-122851474 CTGTTTGAGCTATGATTGTCAGG - Intronic
1048369391 8:133764366-133764388 TTCTTTGTGCTCCTAGTGTCTGG + Intergenic
1050410993 9:5364564-5364586 CTGACTGTGCTACAAATGTGTGG + Intronic
1191847011 X:65554504-65554526 CCCTTTGTCCTACAAGGGTCTGG + Intergenic
1193156740 X:78182749-78182771 CTGTTTGTGGGAGAAGTTTCTGG + Intergenic
1194032611 X:88835345-88835367 CTGATAGTGTTATAAGTGTCTGG - Intergenic
1194376313 X:93137650-93137672 CTGGTGGCTCTACAAGTGTCAGG - Intergenic
1196089308 X:111722836-111722858 CTATTTGGGAGACAAGTGTCAGG + Exonic
1198239596 X:134770812-134770834 GTGTATGTGCTATAAGTGTGAGG - Intronic
1199363004 X:146944325-146944347 CTGTTTTTGTTCCAAGTTTCGGG - Intergenic
1199476877 X:148255461-148255483 CTGTTAGTTTTATAAGTGTCTGG + Intergenic