ID: 1065880861

View in Genome Browser
Species Human (GRCh38)
Location 10:30036717-30036739
Sequence CAGGCTCAGGATTTTGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065880861_1065880865 -10 Left 1065880861 10:30036717-30036739 CCATGAACAAAATCCTGAGCCTG 0: 1
1: 0
2: 2
3: 13
4: 236
Right 1065880865 10:30036730-30036752 CCTGAGCCTGGTCCTCCCGTGGG No data
1065880861_1065880875 26 Left 1065880861 10:30036717-30036739 CCATGAACAAAATCCTGAGCCTG 0: 1
1: 0
2: 2
3: 13
4: 236
Right 1065880875 10:30036766-30036788 CAGTCAGCCATGCTTCGCTGTGG No data
1065880861_1065880866 -9 Left 1065880861 10:30036717-30036739 CCATGAACAAAATCCTGAGCCTG 0: 1
1: 0
2: 2
3: 13
4: 236
Right 1065880866 10:30036731-30036753 CTGAGCCTGGTCCTCCCGTGGGG No data
1065880861_1065880867 -8 Left 1065880861 10:30036717-30036739 CCATGAACAAAATCCTGAGCCTG 0: 1
1: 0
2: 2
3: 13
4: 236
Right 1065880867 10:30036732-30036754 TGAGCCTGGTCCTCCCGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065880861 Original CRISPR CAGGCTCAGGATTTTGTTCA TGG (reversed) Intronic
900091508 1:922773-922795 CAGGGTCAGGTTTATGCTCAAGG + Intergenic
900678811 1:3904691-3904713 CAGGGTCCGTGTTTTGTTCACGG + Intergenic
901199614 1:7459220-7459242 CAGGCTCAGCAGTTTGTCTAAGG - Intronic
902169551 1:14598978-14599000 CATGCTCAGGATTTTGGCCTGGG - Exonic
903112666 1:21150084-21150106 CTGGCTCAGGATTCTCTTAATGG - Intronic
903469205 1:23573777-23573799 GAGGCTAAGCATGTTGTTCAAGG + Intergenic
903955229 1:27021008-27021030 GAGGCTAAGTAATTTGTTCAGGG + Intergenic
917767674 1:178240770-178240792 CAGTCACACAATTTTGTTCAGGG - Intronic
919280596 1:195484042-195484064 CATGCTCCAAATTTTGTTCACGG + Intergenic
920254284 1:204643907-204643929 GAGGTTCAGTAATTTGTTCAAGG - Intronic
920268824 1:204747404-204747426 CAGGCTCTGGATCTTTTTCTTGG + Intergenic
921192313 1:212721673-212721695 CTGGCTTAGGATTCTGCTCATGG + Intergenic
921629883 1:217420426-217420448 CATGCTTAGGCTCTTGTTCAAGG + Intergenic
922090765 1:222393131-222393153 CAGCCTCAGGTATTTCTTCATGG - Intergenic
923953502 1:238988511-238988533 AAGGCCCATGATTTTGTTGAAGG - Intergenic
924880336 1:248154542-248154564 CAGGCTCATGTCTTTGTTCCTGG + Intergenic
1064417014 10:15158801-15158823 CAGGGTCAGGTTTTTGGTGAGGG + Intronic
1065855505 10:29826974-29826996 CAGGCTCAGGAAATTTTCCAGGG + Intergenic
1065880861 10:30036717-30036739 CAGGCTCAGGATTTTGTTCATGG - Intronic
1066239206 10:33516933-33516955 CCAGCTGAGGATTTTGTTTAAGG + Intergenic
1066644942 10:37596909-37596931 CAGGCTCAGGATTTAATTTGAGG - Intergenic
1066974807 10:42357740-42357762 CAGGCTCTGTATATTGTTCTGGG - Intergenic
1067981866 10:51096318-51096340 CAGGCTCAGTCTTTAGTTCATGG - Intronic
1070159969 10:73860444-73860466 AAGGGTCAGGATTTTGTTTGTGG - Intronic
1070821327 10:79356538-79356560 TAGGCTCAGGCCTTTGTGCAGGG - Intergenic
1071667089 10:87568949-87568971 CAGTCTCAGGTATTTCTTCATGG + Intergenic
1072363196 10:94680875-94680897 GAGATTCAGTATTTTGTTCAAGG - Intergenic
1072383819 10:94902938-94902960 GAGATTCAGTATTTTGTTCAAGG - Intergenic
1072878022 10:99194687-99194709 CAGGTTTTGGATTTTTTTCATGG - Intronic
1073469571 10:103714381-103714403 CTGGCACAGGATTTTCTTCAGGG - Intronic
1073681559 10:105709809-105709831 CAGGCTGATGATCTTGGTCAGGG + Intergenic
1074122559 10:110503915-110503937 CAGGGACAGGGTTTTGTTCATGG - Intronic
1074209560 10:111317730-111317752 AAGGCTAAGGAATTTGTCCAAGG - Intergenic
1076214029 10:128678631-128678653 GAGGCAGAGGACTTTGTTCATGG + Intergenic
1079819861 11:25112560-25112582 CTGGTCCAGGATTTTATTCAGGG + Intergenic
1080779007 11:35413564-35413586 CAGAATCAGGATTTTTTTTAAGG + Intronic
1082038661 11:47666557-47666579 CAGGGATAGTATTTTGTTCAAGG + Intronic
1083157414 11:60832813-60832835 CATACTCAGGAGCTTGTTCAAGG - Intergenic
1083704760 11:64506266-64506288 TAGCCTCAGGAGCTTGTTCATGG + Intergenic
1084462231 11:69302460-69302482 CAGGCCCAGAATTGTGTTCCTGG - Intronic
1085170523 11:74445764-74445786 CAGGCTTAGGAATTTGTAGAGGG + Intergenic
1085172096 11:74458018-74458040 CAGGCTCAGGTATTTCTTCATGG + Intronic
1085265412 11:75235310-75235332 CAGGCCCAGGATCCTGATCATGG - Intergenic
1087294966 11:96360921-96360943 CATGTTCAGATTTTTGTTCATGG + Intronic
1087439191 11:98161361-98161383 CAGGCTCAGGCTTGTGAGCAGGG - Intergenic
1089999087 11:122938451-122938473 TAGCCTCATGTTTTTGTTCATGG + Intronic
1090426215 11:126608621-126608643 CAGCCACAGGATTTTGTGTATGG - Intronic
1093021745 12:14210277-14210299 CTGCCTCAGAATTTGGTTCATGG - Intergenic
1093280025 12:17182301-17182323 CAGGCTCAACATTTTTTTCTAGG - Intergenic
1096598879 12:52715444-52715466 CAGGCACAGCCTCTTGTTCAGGG - Intergenic
1096868301 12:54578097-54578119 CAGCCTCTGGATTCTCTTCATGG + Exonic
1097134273 12:56838487-56838509 CAGGATCAGGAATTTGTTTCAGG - Intergenic
1097477012 12:60070344-60070366 CAGTCTCAGGTATTTCTTCATGG + Intergenic
1100874258 12:98945599-98945621 CAGACTCAGGAGTTTGTAAATGG - Intronic
1102139665 12:110604382-110604404 AAGGCTCAGGAATTGGTTGAAGG + Intergenic
1107709499 13:43137843-43137865 CAGGCTAAGTAATTTGCTCAGGG + Intergenic
1108471105 13:50767528-50767550 CATGCTCAAGACTTAGTTCATGG + Intronic
1109227315 13:59712772-59712794 CAGACACAGGATTGTTTTCATGG - Intronic
1110263511 13:73512896-73512918 CAGTCTCAGGTGTTTCTTCATGG + Intergenic
1111721706 13:91954618-91954640 CAGCCTTTGGAGTTTGTTCATGG - Intronic
1112505107 13:99970668-99970690 CAGGTTCAGGTTTAAGTTCACGG + Exonic
1113448004 13:110385331-110385353 CAGGATGAGGATTTTCTTCATGG - Intronic
1114352369 14:21866988-21867010 CAGGCTGGGAATTTTGTCCAGGG + Intergenic
1118432643 14:65736102-65736124 TAGGCTAAGCAATTTGTTCAAGG - Intronic
1119770913 14:77220220-77220242 GAGGCTGAGGAATTTGCTCAAGG - Intronic
1120221284 14:81737067-81737089 CAGGTCAAGGATTTTCTTCAAGG + Intergenic
1120760881 14:88284206-88284228 CAGGTTCTGGATTTTCTTCTTGG - Intronic
1121239318 14:92416755-92416777 CAGGGTCTGGATTTTATTCTTGG - Intronic
1121363642 14:93286651-93286673 TAGGCTCAGGAATTTGGGCATGG - Intronic
1126759933 15:51960844-51960866 CAGGCTCAGCATTATGTTTTTGG - Intronic
1126815565 15:52450020-52450042 CAGGCTCAGGCTTTAGAGCAGGG + Intronic
1128338142 15:66801759-66801781 GAGGCTCAGAAGTTTGTCCAAGG + Intergenic
1128514144 15:68331757-68331779 CTGGTTCAGGATTTTCTTCCAGG - Intronic
1129168037 15:73790250-73790272 CAGGATCAGGATATTGCTCCAGG - Intergenic
1130132044 15:81151963-81151985 CAGGCTTAGAGATTTGTTCAGGG + Intergenic
1130351392 15:83094929-83094951 CATGCTCAGGAGTTTCTCCAGGG - Intergenic
1131792536 15:95980736-95980758 CATGTTCAAGAGTTTGTTCATGG + Intergenic
1131960158 15:97781824-97781846 CAGGGTCAGGATAGAGTTCAGGG - Intergenic
1134301582 16:12996417-12996439 CAGGCTCAGGAGGGTGTTCTGGG - Intronic
1137883786 16:52080165-52080187 CAGGCTTAACATCTTGTTCAAGG + Intergenic
1138851437 16:60634248-60634270 CAGGGCCAGGATTTGGTTCCTGG - Intergenic
1139661351 16:68423138-68423160 CAGAGTCAGGATTTTGACCAAGG + Intronic
1140284852 16:73592580-73592602 CTGCCTCAGGATTATTTTCAGGG - Intergenic
1141485451 16:84336440-84336462 CAGGTTTTGGATTTTTTTCATGG - Intergenic
1145810069 17:27759220-27759242 CAGGCTCAGGATGAGGTGCATGG + Intronic
1146114278 17:30120747-30120769 CAGGTTAAGTAATTTGTTCAAGG + Intronic
1146506018 17:33406023-33406045 CTGGCCCAGGTTTTTTTTCATGG - Intronic
1147786033 17:42979614-42979636 CAGGCCCAGGTATGTGTTCATGG - Exonic
1149522431 17:57327813-57327835 CAGGCTCAGCCTTCTGTTCAGGG + Intronic
1150888435 17:69114807-69114829 CAGGCTGAGGTTTTCCTTCACGG + Exonic
1151981166 17:77510085-77510107 CAGTTTCAGGATGTTGTTGATGG - Intergenic
1152326418 17:79642035-79642057 CAGTCTCAGGAATTTCTTTATGG + Intergenic
1154523171 18:15252138-15252160 CAGGCTCTGTATATTGTTCTGGG + Intergenic
1155682305 18:28503279-28503301 AAAACTCAGGATTTTGTTCTTGG + Intergenic
1156901453 18:42305081-42305103 CAGGCCCAGGAGTTTTTCCATGG - Intergenic
1158209067 18:55025892-55025914 CAGGCTCAGGGTTTGGTTCAAGG + Intergenic
1159756499 18:72371953-72371975 TAAACTCAGGATTTTGTTTAGGG - Intergenic
1160518305 18:79490326-79490348 CAGGCTCAGGCTCTCGGTCATGG + Intronic
1161261748 19:3341647-3341669 CTTGCTCAGGATGTGGTTCAGGG - Intergenic
1164378114 19:27707355-27707377 CAGGCTAAGTTTATTGTTCACGG - Intergenic
1164720106 19:30425718-30425740 CAGCCTCAGTAATTGGTTCAAGG - Intronic
1164796565 19:31038395-31038417 CATGCTCAGAATTATGTTTATGG - Intergenic
1166103380 19:40584515-40584537 CATACTCTGGAATTTGTTCATGG - Intronic
1167593052 19:50414781-50414803 CAGGCTCAGGGTCTTGGCCATGG + Intronic
1168078582 19:53993293-53993315 CGGGCTCAGGCTTTTGTCCCTGG - Intronic
926341873 2:11910450-11910472 ATGCCTCTGGATTTTGTTCATGG - Intergenic
927329890 2:21850244-21850266 GATGCTCAGGATATTGGTCAGGG + Intergenic
928468943 2:31554275-31554297 CAGGCTCAACTTTTTTTTCAGGG - Intronic
928553825 2:32401533-32401555 CAAGCTCAGGAGTTGATTCAAGG + Exonic
930047518 2:47186198-47186220 CAGGATCAGCATTTTATTCAAGG + Intergenic
930430268 2:51266299-51266321 CAGGCTTAGGATTTTATTTTTGG + Intergenic
933615559 2:84479178-84479200 CAGGCACAGGATCGGGTTCAGGG + Intergenic
934977067 2:98810167-98810189 AGGGCTCAGGATCTAGTTCAGGG + Intronic
935158852 2:100511501-100511523 CAGGCTCAGTATTTTCTTAATGG - Intergenic
935264798 2:101385073-101385095 CAGCCTCAGGTATTTGTTTACGG + Intronic
935800412 2:106690066-106690088 CAGTCTCAGGTATTTCTTCATGG - Intergenic
937019347 2:118635906-118635928 TAGGTTAAGTATTTTGTTCATGG - Intergenic
937432888 2:121854483-121854505 CAGTCACAGTATTTTTTTCAGGG + Intergenic
938364526 2:130724309-130724331 CAGCCTCAGGTATTTCTTCATGG + Intergenic
938522474 2:132085009-132085031 CAGGCTCTGTATATTGTTCTGGG + Intergenic
942111345 2:172685367-172685389 CAGCCTCAGGATTTTAATCCAGG - Intergenic
945857637 2:215087298-215087320 CTGGATCAGGATATTCTTCACGG + Intronic
946031148 2:216706144-216706166 CAGGCACAGTATTATGTTTATGG + Intergenic
946560110 2:220903309-220903331 CAGGCTCTGGACTTTGGTCGGGG - Intergenic
948405317 2:237713048-237713070 CAGGCTCAGGGTTTTCTTGAGGG + Intronic
948442428 2:238003023-238003045 CATGGTCAGGATGTTGGTCAAGG - Intronic
948513761 2:238489983-238490005 CAGGCCCAGGATTCTGAGCAGGG + Intergenic
948615525 2:239196387-239196409 CAAGGTCAGGATGTTGCTCACGG - Intronic
1171147865 20:22801491-22801513 CAGGGTCAGGATTAGGTTCGGGG + Intergenic
1171993925 20:31717833-31717855 CAGGCTAAGGGATTTCTTCAGGG + Intronic
1172192324 20:33069390-33069412 CAGGCTCAGGTGTTTGGCCATGG - Intronic
1173851533 20:46221511-46221533 CAGTCTCAGGACTGTGTTCCAGG + Intronic
1174755279 20:53152455-53152477 CAGGGTCAGGATTAGGGTCAGGG - Intronic
1176774215 21:13116049-13116071 CAGGCTCTGTATATTGTTCTGGG - Intergenic
1178302438 21:31464339-31464361 CAGGCTCAGAATCCTGTTCAAGG + Intronic
1178419892 21:32435039-32435061 CAGGTTCAGTAATTTGCTCATGG + Intronic
1178554461 21:33575970-33575992 CAGGATTAAGATTCTGTTCATGG + Intronic
1180521839 22:16215772-16215794 CAGGCTCTGTATATTGTTCTGGG - Intergenic
1182595272 22:31414966-31414988 CAGTCTCACTATGTTGTTCAGGG + Intronic
1183865065 22:40697750-40697772 CAGGTACAGGATTTCTTTCAGGG + Intergenic
1184056214 22:42051773-42051795 CAGGCCCAGGCTTTTCTACATGG - Intronic
1184251813 22:43264825-43264847 CAGGCCTAGGATTTAGTTTATGG - Intronic
949120287 3:375789-375811 TAGGCTCAATGTTTTGTTCAAGG + Intronic
949544237 3:5058717-5058739 CAGGCTTAGCATATTTTTCAGGG + Intergenic
953257035 3:41301008-41301030 CAGGCTCAGGGACTTGTCCAAGG + Intronic
956030606 3:65033326-65033348 TAGGTTAAGGAATTTGTTCAAGG + Intergenic
959945423 3:112120650-112120672 CAGGCTCAGGTTCTTTATCAGGG + Intronic
962210754 3:133475683-133475705 CAGCCTCAGAATTTTCTTCCAGG + Intergenic
962546904 3:136446104-136446126 TAGGCTAAGGATTTTGATAACGG - Intronic
965278210 3:166715452-166715474 GAGGCTTAGAATTTTGTTCTTGG - Intergenic
968472527 4:788580-788602 CAGGGTCAGGGCTTTGTTCTGGG - Intronic
969155992 4:5210346-5210368 CAGGCCCAGGCTGTTGTGCATGG - Intronic
969538638 4:7772043-7772065 CAGGCTCAGCATTTTACTGAGGG + Intronic
969820666 4:9717817-9717839 CAGGTTCAGTAGTTTGCTCATGG + Intergenic
971125564 4:23750252-23750274 CAGGCTCAGTATCTTGTTGCAGG - Intergenic
971218936 4:24687326-24687348 CAGAGTCAGGATTTGATTCATGG - Intergenic
973215475 4:47664408-47664430 GAGACTCAGGATTTTGTCTAAGG + Intronic
976520020 4:86016073-86016095 CAGGCTCATTTTTTTGTTGAAGG + Intronic
977037794 4:91976824-91976846 CAGTCTCAGGCATTTCTTCATGG + Intergenic
978221579 4:106282100-106282122 CAGGTTTTGGATTTTTTTCATGG + Intronic
979016716 4:115443652-115443674 CAGGTTCAGGAGTTTGGACAAGG + Intergenic
979500577 4:121435135-121435157 CGCTATCAGGATTTTGTTCAAGG + Intergenic
980722733 4:136719108-136719130 CATGCTCCAAATTTTGTTCATGG - Intergenic
980742841 4:136974319-136974341 CAGTCTCAGGTATTTCTTCATGG - Intergenic
981831191 4:149004123-149004145 CAATAACAGGATTTTGTTCATGG + Intergenic
984500592 4:180553894-180553916 CAGCCCTAGCATTTTGTTCAAGG - Intergenic
984894120 4:184520560-184520582 CTGGGTCAAGATTTTCTTCATGG + Intergenic
985135754 4:186784183-186784205 CAGAATCTAGATTTTGTTCAGGG - Intergenic
986204091 5:5607212-5607234 CAGTCTCAGGTATTTCTTCATGG - Intergenic
987221565 5:15795654-15795676 CAGCTTATGGATTTTGTTCATGG + Intronic
988501672 5:31788954-31788976 AGGACTCAGGATTATGTTCAGGG + Intronic
990977547 5:61572868-61572890 CAGGCTCAGGGTCTTGCTCAGGG - Intergenic
991386127 5:66092390-66092412 CAGGCTCCTGAATTTTTTCAGGG - Intergenic
991961677 5:72051022-72051044 CAGTCTCAGGTATTTCTTCATGG - Intergenic
993538548 5:89119168-89119190 CATGGTCAGAATTTTGTTCTGGG + Intergenic
995550697 5:113278210-113278232 CAGGTTAAGGATCTTGTCCAAGG - Intronic
996483403 5:124001388-124001410 CAGGCTCAGGAATTTTGTGAGGG + Intergenic
996829020 5:127719709-127719731 CTGGCTCAGGGTTCTGCTCATGG + Intergenic
997456002 5:134018044-134018066 CAGCCTCAGGTATTTCTTCATGG - Intergenic
998140023 5:139694466-139694488 TAGGCTCAGGATTTTATTTTGGG + Intergenic
1000980482 5:167811559-167811581 CAGTCTCAGGAATTTCTTTATGG + Intronic
1001040013 5:168327737-168327759 CACACTCAGGCTTTTGTTAAGGG - Intronic
1001235426 5:170025448-170025470 CAGGGTCAGGATTTAGATCAGGG - Intronic
1003263485 6:4546463-4546485 CAGGCTCAGGATGGGGTTCTGGG - Intergenic
1004004317 6:11625141-11625163 GCGTCTCAGGATTCTGTTCATGG + Intergenic
1004887606 6:20066826-20066848 CAGTCTCAGGTATTTCTTCATGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1008617424 6:53240008-53240030 CAGAACCTGGATTTTGTTCAAGG + Intergenic
1010289034 6:74114533-74114555 AAGGCTGAGGATTGAGTTCAGGG + Intergenic
1010700041 6:79033267-79033289 CAGGCTGACTCTTTTGTTCAGGG - Intronic
1013471836 6:110473032-110473054 AAGGCTAAGGATCTTGCTCATGG - Intronic
1014857963 6:126426051-126426073 CAGGCACTGGATTTTTGTCAGGG - Intergenic
1016084142 6:139892416-139892438 CAAGTTCAGGATTTTTCTCATGG + Intergenic
1016761942 6:147747340-147747362 GAGGGGCAGGATGTTGTTCAGGG + Intergenic
1017596294 6:156032065-156032087 AAGGCTAAGTATCTTGTTCAAGG - Intergenic
1019344906 7:524832-524854 AAGGCTCTGGATTTTATTCTAGG + Intergenic
1019675595 7:2310251-2310273 CAGGATAAGGGTTTTTTTCAGGG - Intronic
1019849687 7:3542232-3542254 CAGGGTCATGATTTTACTCAAGG - Intronic
1022506823 7:30912696-30912718 CAGGCTGGGCATTTGGTTCAGGG - Intronic
1030420539 7:109302022-109302044 ATGGCTCCAGATTTTGTTCAGGG - Intergenic
1032106704 7:129037684-129037706 TAGCCTAAGGCTTTTGTTCAGGG - Intronic
1032150734 7:129427368-129427390 CAGGCTCACGAGTTAGTCCAGGG + Exonic
1033249848 7:139749014-139749036 CAAGGTCAGGTTTTTGTTCTTGG - Intronic
1034267504 7:149788382-149788404 CGGGCTCAGGATGCTGCTCATGG - Intergenic
1036923988 8:12885980-12886002 CAGTCTCAGGTATTTCTTCATGG + Intergenic
1037147418 8:15589826-15589848 TAGAATCAGAATTTTGTTCATGG - Intronic
1037807928 8:22068839-22068861 AAGGCTGAGGACTTTGTGCAGGG + Intronic
1039776090 8:40738315-40738337 CAGGGTCTGAACTTTGTTCAAGG - Intronic
1040395227 8:46992430-46992452 AACTCTCAGGATTCTGTTCATGG + Intergenic
1040810022 8:51441295-51441317 CAGTCTCAGGTATTTCTTCATGG + Intronic
1041221293 8:55654393-55654415 CAGGGTAAGGATTTTTTTTAAGG - Intergenic
1043363909 8:79509483-79509505 CTGCATCAGCATTTTGTTCAGGG - Intergenic
1043518210 8:81016297-81016319 GAGGCACAGTAATTTGTTCAAGG + Intronic
1044337648 8:91006518-91006540 GAGGTTAAGGATTTTGCTCAAGG - Intronic
1044531915 8:93316822-93316844 CAGCCTCAGGATTCTGTGAAGGG + Intergenic
1045752011 8:105496607-105496629 CAGGCCCAGCATTTTATTTAAGG + Intronic
1046967506 8:120183920-120183942 CAGGCTCTGGAGTTAGTTCTGGG + Intronic
1047835192 8:128681682-128681704 CAGGCGGAGGAGTTTGTGCAAGG - Intergenic
1048047313 8:130785121-130785143 TGGGCTCTTGATTTTGTTCAAGG + Intronic
1048083703 8:131155789-131155811 CCTGCTCAGGATTTTTTTTATGG + Intergenic
1049432212 8:142570394-142570416 CATGCTCAGGAAGTTGTTCACGG + Intergenic
1052685890 9:31755551-31755573 CAATCCCAGGATTTTGCTCAGGG - Intergenic
1055602059 9:77930056-77930078 CAGGCAGAGATTTTTGTTCAGGG - Intronic
1055858893 9:80724791-80724813 CACTCTCAGCATTTTGGTCAAGG + Intergenic
1056147687 9:83750062-83750084 CTGGCTCAAGCCTTTGTTCAAGG + Intronic
1056711392 9:88994616-88994638 GAAGCTCAGGATGGTGTTCACGG + Exonic
1056778733 9:89533508-89533530 CAGGCTGAGGACTTGGTGCAGGG - Intergenic
1056826053 9:89877120-89877142 CAGGCTGAGGATGGTGTGCAGGG + Intergenic
1056933474 9:90897763-90897785 GAGGCTCAGGAGATTGTCCAGGG - Exonic
1057392995 9:94654600-94654622 CAGCCTCCAGATTTTATTCAAGG - Intergenic
1057472254 9:95368354-95368376 CAGAATCATTATTTTGTTCAGGG - Intergenic
1057603189 9:96477792-96477814 TATGCTCATGATTTTGCTCATGG - Intronic
1058585510 9:106502527-106502549 CAGGCTCTGGTGATTGTTCATGG + Intergenic
1061101976 9:128499044-128499066 AAGGTCCAGGATTTTGTTCTGGG - Exonic
1062345153 9:136111050-136111072 CAGGCTCAGGGATTGGTCCAGGG + Intergenic
1062611217 9:137374472-137374494 CAGCCTCAGGATGTTGCTCCTGG - Intronic
1187560833 X:20401959-20401981 CAGTCTCAGGTATTTCTTCATGG - Intergenic
1187804673 X:23106210-23106232 CAGGATTAGGATTTTATTCCAGG + Intergenic
1188267232 X:28092664-28092686 CAGGCTCTGGTTTTTGTTTGGGG + Intergenic
1188273513 X:28173270-28173292 GAGGCTTAGGATTTTTTTCCTGG + Intergenic
1188684736 X:33055805-33055827 GAGGCTCAGTATTTTGTTCAAGG - Intronic
1189351043 X:40275985-40276007 CTGGGTCAGGAATTTGTGCAGGG + Intergenic
1189663460 X:43327690-43327712 CCCACTCAGGATTCTGTTCAAGG + Intergenic
1192503710 X:71668660-71668682 CATGCTCTGCATTTTCTTCAAGG - Intergenic
1192522472 X:71814712-71814734 CATGCTCTGCATTTTCTTCAAGG - Intergenic
1193971547 X:88061488-88061510 ATGGCTCAGGATTTTGTGCTTGG - Intergenic
1197773832 X:130107453-130107475 CTGGCTCAGGAATTTGATCCTGG + Intronic
1198934301 X:141889768-141889790 CAGGCTGTGGATTTTTTTCCTGG - Intronic
1200036080 X:153331760-153331782 CAGTCTCAGGCATTTTTTCATGG + Intergenic
1200162747 X:154017836-154017858 CCGGCTCAGGATTTGGCCCACGG - Intronic
1200711293 Y:6487119-6487141 AAGCCTCCAGATTTTGTTCAGGG - Intergenic
1201022641 Y:9674867-9674889 AAGCCTCCAGATTTTGTTCAGGG + Intergenic