ID: 1065885199

View in Genome Browser
Species Human (GRCh38)
Location 10:30070678-30070700
Sequence CGGCATATGCTGTAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065885199_1065885204 1 Left 1065885199 10:30070678-30070700 CCCTCCAGCTACAGCATATGCCG 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1065885204 10:30070702-30070724 AGCCACAGTTTTATACATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065885199 Original CRISPR CGGCATATGCTGTAGCTGGA GGG (reversed) Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
900651364 1:3731580-3731602 CTGCAGAGGCAGTAGCTGGAGGG + Intronic
902649568 1:17827753-17827775 TGGCAAATGCTGCAGATGGAAGG + Intergenic
911956556 1:104243073-104243095 TGGCATATGTTGTATATGGATGG + Intergenic
916047734 1:161013318-161013340 CTGGGTATGCTGTAGCTGGTGGG - Intronic
920304780 1:205011597-205011619 GGGCTTACTCTGTAGCTGGAGGG - Intronic
920364273 1:205439933-205439955 GGGCAGAGGCTGAAGCTGGAAGG + Intronic
921185964 1:212669780-212669802 CGGCACAGGCTGCAGCTGGCAGG + Intergenic
921666257 1:217875445-217875467 TGGGATGTGCTGTAGATGGATGG - Intergenic
1064286231 10:13993881-13993903 AGGATTATGCTGCAGCTGGAGGG + Intronic
1064618605 10:17191436-17191458 CTGCAGATGCTTTATCTGGAAGG + Intronic
1065885199 10:30070678-30070700 CGGCATATGCTGTAGCTGGAGGG - Intronic
1069756461 10:70776875-70776897 CAGCAAATGCTACAGCTGGAAGG + Intronic
1070586311 10:77769438-77769460 CGGCGTAACTTGTAGCTGGAAGG - Intergenic
1072729006 10:97832195-97832217 GGGCATGAGCTGAAGCTGGAGGG + Intergenic
1073349951 10:102812673-102812695 CTGCTGCTGCTGTAGCTGGAAGG - Exonic
1081549799 11:44100651-44100673 CCGCATCTCCTGCAGCTGGAGGG + Intronic
1083069312 11:59960550-59960572 CGGCATCTGGTGAAACTGGAAGG + Intergenic
1090385231 11:126354656-126354678 CTGCTTCTGCTGAAGCTGGAGGG - Intergenic
1101853703 12:108424790-108424812 CCTCATCTTCTGTAGCTGGAAGG - Intergenic
1109947687 13:69459205-69459227 TGGCATCTACTATAGCTGGAAGG - Intergenic
1116528998 14:45944040-45944062 CTGCTTATGCTGTAACTGAATGG + Intergenic
1126851045 15:52797197-52797219 GGGCATTTGCTGGTGCTGGAAGG - Intergenic
1129513142 15:76139604-76139626 CTGCAAATGATGTAGCTGGTGGG + Intronic
1130561817 15:84964840-84964862 AGGCCCATGCTGTAGCTGCAAGG + Intergenic
1132711028 16:1267614-1267636 CTGCCTATGCTGCAGCTGTATGG + Intergenic
1138389576 16:56660531-56660553 TGGCATATTCTGCAGTTGGAAGG + Intronic
1140857746 16:78992701-78992723 CTTCATATGCATTAGCTGGAAGG + Intronic
1143079349 17:4369837-4369859 TGGCAAGTGCTGCAGCTGGATGG - Intergenic
1144793816 17:17877665-17877687 CTGAATCTGCTGTTGCTGGAAGG + Intronic
1147671119 17:42177537-42177559 CGGCACATGCCCTAGCTTGAGGG + Intronic
1148779607 17:50113937-50113959 CCGCAGCTGCTGCAGCTGGACGG - Exonic
1153281165 18:3415554-3415576 CGCCCTAGGCTGGAGCTGGAGGG - Intronic
1166048215 19:40242174-40242196 CGGCTTAGGCTGGAGCAGGAAGG + Intronic
940846892 2:158651523-158651545 CGGCACATGCTGGAGCTGGCTGG - Intronic
941890237 2:170572642-170572664 GGGCATATGCTGTTGGTGGGAGG - Intronic
942689272 2:178568134-178568156 TGGCAAATGGTGTACCTGGAGGG + Exonic
943986368 2:194625057-194625079 AGGGATATGCTTTGGCTGGATGG - Intergenic
1172095259 20:32457281-32457303 CGGCAGAGGCTGAAGCTGCACGG + Intronic
1173642045 20:44610163-44610185 CGCCATCTGCTGTAGCCGGGGGG + Intronic
1181087805 22:20450764-20450786 CTGCATATACTGTAGCAGGCTGG - Intronic
953930953 3:47005416-47005438 AGGGAGATGCTGTGGCTGGAGGG - Intronic
954106919 3:48414516-48414538 CGGCCTGTGCAGTAGCTGGGTGG - Intronic
962852475 3:139318398-139318420 AGGCTGATGTTGTAGCTGGAAGG + Intronic
962985244 3:140530614-140530636 CCACATCTGCTGAAGCTGGATGG - Intronic
963657522 3:148076043-148076065 TGCCATATGCTGTGGCTGGAGGG - Intergenic
965860324 3:173141152-173141174 TGGCAGATGCTGTGGCTGGGAGG - Exonic
979708300 4:123747600-123747622 CTGCATATGGTGGTGCTGGAAGG + Intergenic
980092706 4:128458965-128458987 CCGTCTGTGCTGTAGCTGGAGGG + Intergenic
984711504 4:182889311-182889333 GGGCAGATGCTGTCGCTGGGGGG - Intergenic
987366405 5:17152830-17152852 CGGCATATCCTAAATCTGGAAGG + Intronic
991256689 5:64622052-64622074 CCTCATCTTCTGTAGCTGGAGGG - Intergenic
991496502 5:67231829-67231851 CTGCTTTTGCTGTGGCTGGATGG + Intergenic
995043382 5:107615812-107615834 CAGCTTTTGCTGTAACTGGAGGG - Intronic
999083942 5:148870576-148870598 CTCCATGTGCTGTAACTGGAAGG - Intergenic
1002064229 5:176644111-176644133 AGGCCTCGGCTGTAGCTGGAGGG + Intronic
1003073642 6:2964032-2964054 GGGCTTATGCTGGAGCAGGAGGG - Intronic
1005886527 6:30101801-30101823 TGGGATGTGCTGCAGCTGGAAGG - Intergenic
1006206989 6:32355300-32355322 AAGCATATGCAGTAGCTGGTGGG - Intronic
1008071924 6:47106830-47106852 TGGCATACCCTGTAGCTGCATGG - Intergenic
1008570566 6:52812647-52812669 CGACCTATTCTGTAGCTGGATGG - Intergenic
1010238289 6:73593153-73593175 GGGCATATGCTATAGCAAGAAGG + Intergenic
1011115196 6:83882291-83882313 GGGCATCTGCGGTAACTGGAAGG + Intronic
1013418691 6:109947161-109947183 CACCAGGTGCTGTAGCTGGAAGG + Intergenic
1013839363 6:114371982-114372004 CAGCAAAAGCTGTAGCTGCATGG + Intergenic
1015259353 6:131217331-131217353 CGCCACCTGCTGCAGCTGGATGG + Intronic
1019264154 7:103188-103210 CTGCAGATGCGGTTGCTGGATGG - Intergenic
1020121917 7:5509341-5509363 TGGAATTTGCTGTGGCTGGATGG - Intronic
1022193165 7:28036927-28036949 TGGCATCTGCTGTACCTAGAGGG - Intronic
1027192266 7:76003608-76003630 CGGCATATGCTCCATCTGGGTGG - Intronic
1030110985 7:106026813-106026835 CTGCATCTTCTGTGGCTGGAAGG + Intronic
1033659768 7:143395333-143395355 CCGCATATTCTGCATCTGGAAGG - Exonic
1039479278 8:37859790-37859812 CAGCATCTGCAGCAGCTGGAAGG + Exonic
1039536179 8:38315496-38315518 CTGCATCTGCAGTAGCTGAAGGG + Exonic
1042877317 8:73451068-73451090 CGGCAAAGCCTGTAGCTGGCAGG + Intronic
1043083576 8:75798075-75798097 CTCCATCTGCTGTTGCTGGAAGG - Intergenic
1044471561 8:92575176-92575198 TTGCATATCCTATAGCTGGAAGG + Intergenic
1060883395 9:127134081-127134103 CGGCGCCTGCTGCAGCTGGATGG - Intronic
1062478875 9:136742455-136742477 GGGCATATTCTGTAGCGGGAGGG - Intronic
1185869688 X:3653315-3653337 CGACAGATTCTGTACCTGGAGGG - Intronic
1192611727 X:72573346-72573368 AGGCAGCTGATGTAGCTGGATGG - Intergenic
1199702190 X:150389598-150389620 CGTAATATGCTGTTGCTGGATGG + Intronic
1200279166 X:154762418-154762440 GGCCATCTGCTCTAGCTGGATGG + Intergenic