ID: 1065888167

View in Genome Browser
Species Human (GRCh38)
Location 10:30097307-30097329
Sequence CACTAATACCCCAGGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065888167_1065888174 1 Left 1065888167 10:30097307-30097329 CCCTGCAGCCTGGGGTATTAGTG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 1065888174 10:30097331-30097353 GACAAAGGAGGAAATGTCAAAGG No data
1065888167_1065888175 10 Left 1065888167 10:30097307-30097329 CCCTGCAGCCTGGGGTATTAGTG 0: 1
1: 0
2: 0
3: 13
4: 147
Right 1065888175 10:30097340-30097362 GGAAATGTCAAAGGCCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065888167 Original CRISPR CACTAATACCCCAGGCTGCA GGG (reversed) Intronic
900188906 1:1345160-1345182 CACGAAGACCCCAGGCTGCCTGG + Intronic
900720943 1:4175371-4175393 CACAAATACCACAGGCTGGGTGG - Intergenic
901233189 1:7652504-7652526 CACTAAGGCCCCAGCCAGCAAGG + Intronic
903701671 1:25253404-25253426 CTCTTATTGCCCAGGCTGCACGG + Intronic
904595556 1:31642702-31642724 CAGGAATAGCCCAGGCAGCATGG + Intronic
911687024 1:100789347-100789369 CACTAATACTTCAGGCTAAAAGG - Intergenic
912267754 1:108175492-108175514 GACTAATACACCAGGCAACATGG + Intronic
912373354 1:109190743-109190765 CACTACTACCCCAGCCCGCTTGG + Intronic
915951078 1:160190363-160190385 CACTTCTACCCCAGGCTCCCAGG - Intergenic
917760986 1:178157519-178157541 TTCTAATTCCCAAGGCTGCAGGG + Intronic
919490508 1:198199362-198199384 CATTCATTCCCCAAGCTGCAGGG - Intronic
922236884 1:223728674-223728696 CAGTAATAACCCAAGCTGCTTGG + Intronic
1063808957 10:9681521-9681543 CACCAAGTCCCCAGGCTGTACGG - Intergenic
1065888167 10:30097307-30097329 CACTAATACCCCAGGCTGCAGGG - Intronic
1067220322 10:44339528-44339550 CACCAAGTCCCAAGGCTGCAGGG + Intergenic
1067526082 10:47039454-47039476 CACTAACAAACCAGCCTGCAGGG + Intergenic
1067691255 10:48503764-48503786 CACTCATACCCCAGGAGGCCCGG - Intronic
1073139670 10:101238843-101238865 CACTAATATCCCTGGCTGTGTGG - Intergenic
1076895607 10:133309843-133309865 CACCACTACCACACGCTGCACGG + Exonic
1078049023 11:7945758-7945780 CACCATTTCCCCAGGATGCAGGG + Intergenic
1080575415 11:33594476-33594498 CAGGAATACCCCAGGTAGCAAGG + Intronic
1081043902 11:38248499-38248521 CAGTCATACACCAGGCTACATGG + Intergenic
1084377548 11:68788123-68788145 AACAAATACCACAGACTGCACGG - Intronic
1084627226 11:70317763-70317785 CAGTAGTAACTCAGGCTGCATGG + Intronic
1091883281 12:3997236-3997258 CACTAAAACCTCAGGCTGGATGG + Intergenic
1092108775 12:5944642-5944664 CATTTACACCCCAGGCTGCAGGG - Intronic
1092312100 12:7368883-7368905 CACAAATACCTAAGGCTACATGG - Intronic
1092521126 12:9274324-9274346 TATTACTACCCCAGGCTCCACGG - Intergenic
1096140296 12:49237382-49237404 CACTCATTGCCCAGGCTGGAGGG - Intronic
1096312806 12:50536300-50536322 CATACATACGCCAGGCTGCATGG + Intronic
1099215847 12:79852789-79852811 TACTAATACCCCTGGGTGCTGGG + Intronic
1101552394 12:105774875-105774897 CACTAATACCACAGACTGTGTGG - Intergenic
1101586168 12:106087895-106087917 AACTAATGCCGCAGGTTGCAGGG + Intronic
1101759842 12:107649473-107649495 CACTAGCACCCCAGCCTGCCAGG - Intronic
1102181174 12:110913371-110913393 CACTGGCACCCCAGGCAGCAGGG + Intronic
1105413183 13:20188629-20188651 CACTGAGACCCCAGGCTGTTAGG - Exonic
1105542586 13:21327809-21327831 CACTGACACCCCAGGCTCCTGGG - Intergenic
1106504026 13:30355810-30355832 CCCTAGTACTCCAGCCTGCAAGG + Intergenic
1106798424 13:33231471-33231493 CTCTAATGCCCTAGCCTGCAGGG - Intronic
1108129855 13:47287038-47287060 CACAAATACACAAGGCTGCCAGG - Intergenic
1113202815 13:107886144-107886166 CACTAATTCTTCAGGCTGCAGGG + Intergenic
1115021251 14:28684041-28684063 CACCAAGTCCCTAGGCTGCACGG - Intergenic
1115790139 14:36869026-36869048 CACCACCACCCCAGGCTGAAGGG - Intronic
1115806989 14:37062870-37062892 CACTAATACACCAGGGTTCAAGG - Intronic
1116668248 14:47806613-47806635 CAATAATACCCCGGACTTCAAGG - Intergenic
1117050472 14:51854911-51854933 CAGTAAGACCTCAGGCTTCATGG + Intronic
1118283490 14:64450143-64450165 CAGGAATACCCCAGGGTGGAGGG + Intronic
1118845516 14:69545111-69545133 AACAAATACCCCAGGCTGGGTGG + Intergenic
1121649834 14:95549836-95549858 GACTAATACACCTGGCTGCCTGG + Intergenic
1122811868 14:104293258-104293280 CACTCTTACCCCAGACTGCCTGG + Intergenic
1128666547 15:69542383-69542405 CACTAAGACACCAAGGTGCAAGG - Intergenic
1128753321 15:70164239-70164261 CACTTTTAACCCAGGCTGCCTGG + Intergenic
1129910292 15:79221123-79221145 CACTTTTACCCCAGGCTGTCAGG - Intergenic
1130901410 15:88209574-88209596 CAGAAAGACCCCAGGCTGAAGGG + Intronic
1130989962 15:88870315-88870337 CACAAACCCCTCAGGCTGCATGG - Intronic
1133319531 16:4904372-4904394 CACTCACAACCCAGTCTGCAAGG + Intronic
1134109920 16:11508801-11508823 CACTCATACAGCAGGCTGCTTGG + Exonic
1135435810 16:22425926-22425948 CAGTGAGATCCCAGGCTGCAGGG + Intronic
1138586344 16:57972738-57972760 TACAAATATGCCAGGCTGCAGGG + Intergenic
1142045021 16:87919756-87919778 CAGTGAGATCCCAGGCTGCATGG + Intronic
1143158875 17:4856162-4856184 CACTTATACCCCAAGGTGCTTGG - Intronic
1143860714 17:9888752-9888774 CAATAATAGGCCAGGCTTCATGG - Intronic
1146194982 17:30803870-30803892 CACTAATACAACAGGCTCCCTGG + Intronic
1146273213 17:31498011-31498033 CCCTAGTACCCCAGGCTCCTGGG - Intronic
1146633560 17:34487815-34487837 CACTCATCTCCCAGGCTGTAGGG - Intergenic
1148063793 17:44854206-44854228 CACTCATATGCCTGGCTGCAAGG + Intronic
1149108563 17:52997945-52997967 CACCACCACCCCAGGCTGCAAGG - Intergenic
1150179459 17:63101627-63101649 CACTAAGACCCCTGCCTTCAAGG + Intronic
1152966571 18:120798-120820 CACAAATATCACAGGCTTCAGGG + Intergenic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1154927415 18:20951268-20951290 CACAAATATCACAGGCTTCAGGG - Exonic
1159853526 18:73556834-73556856 CAGTAATACCCCAGCCTGTTAGG + Intergenic
1161016951 19:1987851-1987873 CCCTAAAAGCCCAGGCAGCAGGG - Intronic
1161352468 19:3801633-3801655 CAGGAAGACACCAGGCTGCAGGG - Exonic
1163831916 19:19551051-19551073 CACAGATACTCCAGTCTGCAGGG + Intergenic
925395018 2:3527140-3527162 CACTCTTCCCCCAGTCTGCAGGG + Intergenic
926314000 2:11696369-11696391 CACTATGTCCCCAGCCTGCATGG - Intronic
930022160 2:47008051-47008073 CCCTACTACCCCAGGCTGACCGG - Intronic
933382956 2:81573173-81573195 CACTAATACCACAGCATACATGG + Intergenic
935102305 2:100008283-100008305 CACAAATACCTTAGGCGGCATGG - Intronic
935140186 2:100346101-100346123 CAAAAATAACCCTGGCTGCAGGG + Intergenic
935588429 2:104823162-104823184 CACCGCTACCCCAGCCTGCATGG + Intergenic
939341000 2:140895903-140895925 CATGAAAACCCCAGGCTCCACGG - Intronic
939998068 2:148938726-148938748 CACTAAGATCCCAGCCTGAAGGG - Intronic
946078023 2:217091924-217091946 CACAAATCCCCTGGGCTGCATGG + Intergenic
1168831650 20:848363-848385 CACAGATCCCCAAGGCTGCAGGG - Intronic
1172193103 20:33074213-33074235 CACTAGCACCCCAGGAAGCAAGG + Intergenic
1172431484 20:34896256-34896278 CAATAATAGCCCAGACTGCAGGG + Intronic
1172977800 20:38919729-38919751 CACAAAGACCCCAGGGTGCTGGG - Exonic
1174085935 20:48007070-48007092 CACTTTTGCCCCAGGCTGCAGGG + Intergenic
1174538394 20:51270622-51270644 CAGAAGTACCCCAGGCAGCATGG - Intergenic
1175236907 20:57520238-57520260 CACTTTCACCCCAGGCTTCAAGG + Intronic
1176172642 20:63702992-63703014 CACTTGTACCTGAGGCTGCAGGG - Intronic
1180018587 21:45104197-45104219 CACAGATACCCAAGGCTGCCAGG - Intronic
1181733694 22:24865907-24865929 CACTAGTACCCCGGCCTGCTAGG + Intronic
1185141613 22:49105667-49105689 CTCTCCCACCCCAGGCTGCAAGG - Intergenic
949235292 3:1801877-1801899 CGCTGTCACCCCAGGCTGCAGGG + Intergenic
950270496 3:11610932-11610954 CACTAGTTTCCCCGGCTGCAAGG - Intronic
950637019 3:14322651-14322673 CACTAATGAGCCAGGCTGCCTGG - Intergenic
951287972 3:20838400-20838422 CACTAATAACTCAGGCCCCAAGG - Intergenic
954943181 3:54393616-54393638 CACCAATTCCCCAGGATGCAGGG - Intronic
956744365 3:72299873-72299895 CACTTAGACCCCTGGGTGCAGGG + Intergenic
958147157 3:89640310-89640332 CACTGATACTCAAGGCTGAAGGG - Intergenic
959204281 3:103284708-103284730 AACCCAAACCCCAGGCTGCAAGG - Intergenic
961672966 3:128548227-128548249 CACTAATACAGCAGACTCCAGGG - Intergenic
965100556 3:164292287-164292309 CACTGACACCTCACGCTGCAGGG + Intergenic
971230231 4:24795554-24795576 CGCTAACAGCCCAGGCTCCAGGG + Exonic
977879396 4:102186916-102186938 CACTAAAAGCCCAGGCTTCACGG + Intergenic
978934170 4:114355121-114355143 CACCAAGTCCCTAGGCTGCATGG + Intergenic
979440241 4:120742168-120742190 CACTAACACCTCACACTGCAGGG + Intronic
980207966 4:129746419-129746441 CACTCACAATCCAGGCTGCATGG + Intergenic
981529309 4:145736392-145736414 CCCTAAAGCCCCAGGGTGCATGG - Intronic
986237811 5:5928261-5928283 CACTTAAACACCAGGCTGAAAGG + Intergenic
990791701 5:59488016-59488038 CACTCACACCCCACACTGCAGGG + Intronic
993729683 5:91407441-91407463 CTCTAATACCTCAGGCTTCTTGG + Intergenic
994322868 5:98413506-98413528 CAATAATACCACAGTCAGCATGG + Intergenic
998438080 5:142130986-142131008 CTCTCATGCCCCAGGCTGGAGGG + Intronic
998528191 5:142861456-142861478 CACTAATACCACAGGAAGCAAGG - Intronic
999749817 5:154619374-154619396 CATCAATACCCCAGGCACCAAGG - Intergenic
1000179222 5:158791528-158791550 GAATAATATTCCAGGCTGCAAGG - Intronic
1003170644 6:3719485-3719507 AACTAACACCCTTGGCTGCAGGG - Intergenic
1003409424 6:5850007-5850029 CACTGACACCCCAGGCTCCTGGG + Intergenic
1006550972 6:34822813-34822835 CTCTTATCACCCAGGCTGCAGGG - Intronic
1006914538 6:37585836-37585858 CTCTGAGACCCCAGGCTCCAGGG - Intergenic
1008413117 6:51206617-51206639 GAGTCCTACCCCAGGCTGCATGG + Intergenic
1009341946 6:62566741-62566763 CAATTATACTCTAGGCTGCAGGG - Intergenic
1013075682 6:106769234-106769256 CACTCATCACCCAGGCTGGAGGG + Intergenic
1017881284 6:158564323-158564345 CACTGAGGCCCCAGGCAGCAGGG - Intronic
1018318401 6:162580979-162581001 CATTAATATCCCAGGCTCCTCGG + Intronic
1020791670 7:12635134-12635156 CACTCATCACCCAGGCTGGAGGG - Intronic
1022509742 7:30927433-30927455 CACTAAACCCACAGGCTGGAAGG - Intergenic
1023194255 7:37617309-37617331 CACTGATACCTCACACTGCAGGG - Intergenic
1025208903 7:57009565-57009587 CACTGAATCCCCAGTCTGCATGG - Intergenic
1025663048 7:63567291-63567313 CACTGAATCCCCAGTCTGCATGG + Intergenic
1027172574 7:75883168-75883190 CATTAATACCCCCTGCTGCTGGG + Intronic
1032436936 7:131908502-131908524 CAGTAATACCCCAAGGGGCAAGG + Intergenic
1033221274 7:139527561-139527583 GCCTTATACCCCAGGCTGGAAGG - Intronic
1034482305 7:151331885-151331907 CACTTGTCCCCCAGGCTGGAGGG - Intergenic
1035369026 7:158367102-158367124 GACTCGTGCCCCAGGCTGCAGGG + Intronic
1036106977 8:5851704-5851726 CACTAAAATCCCAGACTTCACGG + Intergenic
1037704190 8:21304104-21304126 CACTTATACTCCAGCTTGCAGGG + Intergenic
1040107448 8:43548739-43548761 CACTCCCACCTCAGGCTGCATGG - Intergenic
1040287956 8:46110018-46110040 CTCTAAAGCCCCAGGCTTCAGGG - Intergenic
1041458687 8:58087659-58087681 CACTAATACTCCAGGGAACAGGG - Intronic
1042356209 8:67830800-67830822 CACTGACACTCCAGGCTTCAAGG + Intergenic
1044807198 8:96020654-96020676 TACTCATAACCCAGGCAGCAGGG - Intergenic
1045231158 8:100309321-100309343 CCCTAAGGCCCCAGGCAGCACGG + Intronic
1045705857 8:104921604-104921626 CACCTATACCCCAGACTGTAAGG - Intronic
1050019400 9:1268058-1268080 CACCATCACACCAGGCTGCACGG - Intergenic
1051991141 9:23153900-23153922 CATTACCACTCCAGGCTGCATGG - Intergenic
1054875227 9:70089164-70089186 CACTATTACCCCAGGACTCATGG + Intronic
1056277805 9:85010558-85010580 TACTAATACACCACGCTGCCTGG - Intronic
1056763806 9:89432472-89432494 CAATAAAACCACTGGCTGCATGG + Intronic
1056973603 9:91230806-91230828 CACTGATACCTCACACTGCAGGG - Intronic
1057747121 9:97761304-97761326 CACCAATAGCACAGGCTGCAGGG + Intergenic
1061136866 9:128739724-128739746 GACAAATGCTCCAGGCTGCACGG + Intronic
1062721755 9:138048045-138048067 CACACATACCCTAAGCTGCACGG - Intronic
1185648066 X:1629184-1629206 CACTAAAAGCCTAGGCTGCAAGG - Intronic
1196106435 X:111901127-111901149 CATAAACTCCCCAGGCTGCAGGG + Intronic
1200988288 Y:9326088-9326110 CATGAATGTCCCAGGCTGCAGGG + Intergenic
1201393667 Y:13524768-13524790 CACTGATACCTCACACTGCAGGG + Intergenic