ID: 1065890291

View in Genome Browser
Species Human (GRCh38)
Location 10:30115583-30115605
Sequence CTTGATTCACTTGAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065890291_1065890295 6 Left 1065890291 10:30115583-30115605 CCATCCACCTCAAGTGAATCAAG No data
Right 1065890295 10:30115612-30115634 GATCTGATGTAAGAGGTTCGAGG No data
1065890291_1065890294 -1 Left 1065890291 10:30115583-30115605 CCATCCACCTCAAGTGAATCAAG No data
Right 1065890294 10:30115605-30115627 GCTCACAGATCTGATGTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065890291 Original CRISPR CTTGATTCACTTGAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr