ID: 1065892826

View in Genome Browser
Species Human (GRCh38)
Location 10:30135614-30135636
Sequence GTGGCTACAGAGTTCAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065892820_1065892826 6 Left 1065892820 10:30135585-30135607 CCGGCATAATTAAGTAGCCGGCC No data
Right 1065892826 10:30135614-30135636 GTGGCTACAGAGTTCAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065892826 Original CRISPR GTGGCTACAGAGTTCAAACA GGG Intergenic
No off target data available for this crispr