ID: 1065899623

View in Genome Browser
Species Human (GRCh38)
Location 10:30194067-30194089
Sequence TAGGATTTTCAGAATGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065899623_1065899630 28 Left 1065899623 10:30194067-30194089 CCTTGGCCATTCTGAAAATCCTA No data
Right 1065899630 10:30194118-30194140 TCTGTCTGTGTTCTAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065899623 Original CRISPR TAGGATTTTCAGAATGGCCA AGG (reversed) Intergenic
No off target data available for this crispr