ID: 1065902949

View in Genome Browser
Species Human (GRCh38)
Location 10:30224435-30224457
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065902949_1065902953 11 Left 1065902949 10:30224435-30224457 CCTTTTGACTTCTCCAGGCAGTT No data
Right 1065902953 10:30224469-30224491 CTGAAGTCCTGTTACACCCTAGG No data
1065902949_1065902955 13 Left 1065902949 10:30224435-30224457 CCTTTTGACTTCTCCAGGCAGTT No data
Right 1065902955 10:30224471-30224493 GAAGTCCTGTTACACCCTAGGGG No data
1065902949_1065902954 12 Left 1065902949 10:30224435-30224457 CCTTTTGACTTCTCCAGGCAGTT No data
Right 1065902954 10:30224470-30224492 TGAAGTCCTGTTACACCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065902949 Original CRISPR AACTGCCTGGAGAAGTCAAA AGG (reversed) Intergenic
No off target data available for this crispr