ID: 1065907494

View in Genome Browser
Species Human (GRCh38)
Location 10:30271192-30271214
Sequence ACTGCAACATCCACCTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065907494_1065907497 10 Left 1065907494 10:30271192-30271214 CCCTGGTAGGTGGATGTTGCAGT No data
Right 1065907497 10:30271225-30271247 CGCACCACTGCGCTCTAGCCTGG 0: 21
1: 1572
2: 28465
3: 121012
4: 202919
1065907494_1065907498 11 Left 1065907494 10:30271192-30271214 CCCTGGTAGGTGGATGTTGCAGT No data
Right 1065907498 10:30271226-30271248 GCACCACTGCGCTCTAGCCTGGG 0: 43
1: 3681
2: 57203
3: 146727
4: 211131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065907494 Original CRISPR ACTGCAACATCCACCTACCA GGG (reversed) Intergenic
No off target data available for this crispr