ID: 1065908811

View in Genome Browser
Species Human (GRCh38)
Location 10:30283546-30283568
Sequence CCATTAGGACACAGGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065908811_1065908819 3 Left 1065908811 10:30283546-30283568 CCATGCTCCCTGTGTCCTAATGG No data
Right 1065908819 10:30283572-30283594 AGGGCTCTTCTTGAGTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065908811 Original CRISPR CCATTAGGACACAGGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr