ID: 1065916570

View in Genome Browser
Species Human (GRCh38)
Location 10:30358431-30358453
Sequence CTGCCTAGGTGCCGTGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065916564_1065916570 14 Left 1065916564 10:30358394-30358416 CCGAGGGGGCTGAGCATTGGTCT No data
Right 1065916570 10:30358431-30358453 CTGCCTAGGTGCCGTGGGAGAGG No data
1065916563_1065916570 15 Left 1065916563 10:30358393-30358415 CCCGAGGGGGCTGAGCATTGGTC 0: 3
1: 4
2: 4
3: 11
4: 110
Right 1065916570 10:30358431-30358453 CTGCCTAGGTGCCGTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065916570 Original CRISPR CTGCCTAGGTGCCGTGGGAG AGG Intronic
No off target data available for this crispr