ID: 1065918473

View in Genome Browser
Species Human (GRCh38)
Location 10:30371076-30371098
Sequence TCAGGGTAGCAGATGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065918463_1065918473 17 Left 1065918463 10:30371036-30371058 CCACTGCACTTTGGCCCAGGGCC 0: 1
1: 0
2: 2
3: 44
4: 353
Right 1065918473 10:30371076-30371098 TCAGGGTAGCAGATGATGCAGGG No data
1065918466_1065918473 -4 Left 1065918466 10:30371057-30371079 CCTCTTACCTCCAGATCCTTCAG 0: 12
1: 33
2: 4
3: 24
4: 273
Right 1065918473 10:30371076-30371098 TCAGGGTAGCAGATGATGCAGGG No data
1065918459_1065918473 26 Left 1065918459 10:30371027-30371049 CCTACAGGGCCACTGCACTTTGG 0: 1
1: 0
2: 2
3: 24
4: 183
Right 1065918473 10:30371076-30371098 TCAGGGTAGCAGATGATGCAGGG No data
1065918465_1065918473 2 Left 1065918465 10:30371051-30371073 CCAGGGCCTCTTACCTCCAGATC 0: 17
1: 24
2: 4
3: 30
4: 268
Right 1065918473 10:30371076-30371098 TCAGGGTAGCAGATGATGCAGGG No data
1065918464_1065918473 3 Left 1065918464 10:30371050-30371072 CCCAGGGCCTCTTACCTCCAGAT 0: 18
1: 24
2: 5
3: 22
4: 196
Right 1065918473 10:30371076-30371098 TCAGGGTAGCAGATGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065918473 Original CRISPR TCAGGGTAGCAGATGATGCA GGG Intronic
No off target data available for this crispr