ID: 1065922095

View in Genome Browser
Species Human (GRCh38)
Location 10:30401901-30401923
Sequence GCAGAATATTCGGCCGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065922088_1065922095 13 Left 1065922088 10:30401865-30401887 CCCAAAGCCTCAGGCATACAAAA No data
Right 1065922095 10:30401901-30401923 GCAGAATATTCGGCCGGGTGCGG No data
1065922089_1065922095 12 Left 1065922089 10:30401866-30401888 CCAAAGCCTCAGGCATACAAAAA No data
Right 1065922095 10:30401901-30401923 GCAGAATATTCGGCCGGGTGCGG No data
1065922090_1065922095 6 Left 1065922090 10:30401872-30401894 CCTCAGGCATACAAAAACATTCT No data
Right 1065922095 10:30401901-30401923 GCAGAATATTCGGCCGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065922095 Original CRISPR GCAGAATATTCGGCCGGGTG CGG Intergenic
No off target data available for this crispr