ID: 1065922493

View in Genome Browser
Species Human (GRCh38)
Location 10:30404875-30404897
Sequence CTTTATAAGCAGCATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065922487_1065922493 19 Left 1065922487 10:30404833-30404855 CCAAACCTCTTTCCTTTATAAAT No data
Right 1065922493 10:30404875-30404897 CTTTATAAGCAGCATGAGAATGG No data
1065922492_1065922493 -7 Left 1065922492 10:30404859-30404881 CCAGTCTTGGGTATGTCTTTATA 0: 71
1: 2623
2: 5309
3: 10042
4: 11679
Right 1065922493 10:30404875-30404897 CTTTATAAGCAGCATGAGAATGG No data
1065922488_1065922493 14 Left 1065922488 10:30404838-30404860 CCTCTTTCCTTTATAAATTATCC 0: 277
1: 4268
2: 8719
3: 9110
4: 8100
Right 1065922493 10:30404875-30404897 CTTTATAAGCAGCATGAGAATGG No data
1065922489_1065922493 7 Left 1065922489 10:30404845-30404867 CCTTTATAAATTATCCAGTCTTG 0: 111
1: 1630
2: 2781
3: 4257
4: 3678
Right 1065922493 10:30404875-30404897 CTTTATAAGCAGCATGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065922493 Original CRISPR CTTTATAAGCAGCATGAGAA TGG Intergenic
No off target data available for this crispr