ID: 1065923779

View in Genome Browser
Species Human (GRCh38)
Location 10:30417562-30417584
Sequence TTGGATGGGGACCAGCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065923768_1065923779 21 Left 1065923768 10:30417518-30417540 CCTGTACCTGCCAGTGGTTGCAA No data
Right 1065923779 10:30417562-30417584 TTGGATGGGGACCAGCATCTGGG No data
1065923770_1065923779 15 Left 1065923770 10:30417524-30417546 CCTGCCAGTGGTTGCAAGGCAGA No data
Right 1065923779 10:30417562-30417584 TTGGATGGGGACCAGCATCTGGG No data
1065923772_1065923779 11 Left 1065923772 10:30417528-30417550 CCAGTGGTTGCAAGGCAGAGGAA No data
Right 1065923779 10:30417562-30417584 TTGGATGGGGACCAGCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065923779 Original CRISPR TTGGATGGGGACCAGCATCT GGG Intergenic
No off target data available for this crispr