ID: 1065925480

View in Genome Browser
Species Human (GRCh38)
Location 10:30431530-30431552
Sequence CACACAAGGCGGGTGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065925471_1065925480 7 Left 1065925471 10:30431500-30431522 CCAGAAGATTAGGTGTGGTTTTA No data
Right 1065925480 10:30431530-30431552 CACACAAGGCGGGTGGGGAGGGG No data
1065925470_1065925480 8 Left 1065925470 10:30431499-30431521 CCCAGAAGATTAGGTGTGGTTTT No data
Right 1065925480 10:30431530-30431552 CACACAAGGCGGGTGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065925480 Original CRISPR CACACAAGGCGGGTGGGGAG GGG Intergenic
No off target data available for this crispr