ID: 1065926027

View in Genome Browser
Species Human (GRCh38)
Location 10:30434334-30434356
Sequence CCGCGGCTGGAGCGCTCGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065926022_1065926027 -7 Left 1065926022 10:30434318-30434340 CCGAACCTTCGGGGGGCCGCGGC 0: 1
1: 0
2: 0
3: 16
4: 487
Right 1065926027 10:30434334-30434356 CCGCGGCTGGAGCGCTCGGCCGG 0: 1
1: 0
2: 0
3: 17
4: 166
1065926014_1065926027 11 Left 1065926014 10:30434300-30434322 CCTGCAGCCAGCATCGCACCGAA 0: 1
1: 0
2: 0
3: 19
4: 376
Right 1065926027 10:30434334-30434356 CCGCGGCTGGAGCGCTCGGCCGG 0: 1
1: 0
2: 0
3: 17
4: 166
1065926013_1065926027 18 Left 1065926013 10:30434293-30434315 CCACAGGCCTGCAGCCAGCATCG 0: 1
1: 0
2: 1
3: 26
4: 268
Right 1065926027 10:30434334-30434356 CCGCGGCTGGAGCGCTCGGCCGG 0: 1
1: 0
2: 0
3: 17
4: 166
1065926015_1065926027 4 Left 1065926015 10:30434307-30434329 CCAGCATCGCACCGAACCTTCGG 0: 1
1: 0
2: 0
3: 1
4: 12
Right 1065926027 10:30434334-30434356 CCGCGGCTGGAGCGCTCGGCCGG 0: 1
1: 0
2: 0
3: 17
4: 166
1065926012_1065926027 19 Left 1065926012 10:30434292-30434314 CCCACAGGCCTGCAGCCAGCATC 0: 1
1: 0
2: 2
3: 24
4: 296
Right 1065926027 10:30434334-30434356 CCGCGGCTGGAGCGCTCGGCCGG 0: 1
1: 0
2: 0
3: 17
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065926027 Original CRISPR CCGCGGCTGGAGCGCTCGGC CGG Exonic