ID: 1065928563

View in Genome Browser
Species Human (GRCh38)
Location 10:30458219-30458241
Sequence CTTACTATGTACAGGTAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 106}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065928563_1065928571 -7 Left 1065928563 10:30458219-30458241 CCCTCCTACCTGTACATAGTAAG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1065928571 10:30458235-30458257 TAGTAAGTGGGGTTCAACCAGGG 0: 1
1: 0
2: 1
3: 7
4: 96
1065928563_1065928576 3 Left 1065928563 10:30458219-30458241 CCCTCCTACCTGTACATAGTAAG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1065928576 10:30458245-30458267 GGTTCAACCAGGGCTGGGGGCGG 0: 1
1: 0
2: 2
3: 32
4: 336
1065928563_1065928570 -8 Left 1065928563 10:30458219-30458241 CCCTCCTACCTGTACATAGTAAG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1065928570 10:30458234-30458256 ATAGTAAGTGGGGTTCAACCAGG 0: 1
1: 0
2: 2
3: 3
4: 57
1065928563_1065928577 6 Left 1065928563 10:30458219-30458241 CCCTCCTACCTGTACATAGTAAG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1065928577 10:30458248-30458270 TCAACCAGGGCTGGGGGCGGCGG 0: 1
1: 1
2: 12
3: 194
4: 1501
1065928563_1065928582 10 Left 1065928563 10:30458219-30458241 CCCTCCTACCTGTACATAGTAAG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1065928582 10:30458252-30458274 CCAGGGCTGGGGGCGGCGGGGGG 0: 1
1: 2
2: 25
3: 206
4: 1652
1065928563_1065928579 8 Left 1065928563 10:30458219-30458241 CCCTCCTACCTGTACATAGTAAG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1065928579 10:30458250-30458272 AACCAGGGCTGGGGGCGGCGGGG 0: 1
1: 0
2: 5
3: 58
4: 568
1065928563_1065928584 12 Left 1065928563 10:30458219-30458241 CCCTCCTACCTGTACATAGTAAG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1065928584 10:30458254-30458276 AGGGCTGGGGGCGGCGGGGGGGG 0: 1
1: 2
2: 42
3: 445
4: 3518
1065928563_1065928574 -1 Left 1065928563 10:30458219-30458241 CCCTCCTACCTGTACATAGTAAG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1065928574 10:30458241-30458263 GTGGGGTTCAACCAGGGCTGGGG 0: 1
1: 0
2: 3
3: 20
4: 230
1065928563_1065928580 9 Left 1065928563 10:30458219-30458241 CCCTCCTACCTGTACATAGTAAG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1065928580 10:30458251-30458273 ACCAGGGCTGGGGGCGGCGGGGG 0: 1
1: 1
2: 10
3: 137
4: 1066
1065928563_1065928578 7 Left 1065928563 10:30458219-30458241 CCCTCCTACCTGTACATAGTAAG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1065928578 10:30458249-30458271 CAACCAGGGCTGGGGGCGGCGGG 0: 1
1: 0
2: 4
3: 58
4: 516
1065928563_1065928572 -3 Left 1065928563 10:30458219-30458241 CCCTCCTACCTGTACATAGTAAG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1065928572 10:30458239-30458261 AAGTGGGGTTCAACCAGGGCTGG 0: 1
1: 0
2: 2
3: 13
4: 142
1065928563_1065928575 0 Left 1065928563 10:30458219-30458241 CCCTCCTACCTGTACATAGTAAG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1065928575 10:30458242-30458264 TGGGGTTCAACCAGGGCTGGGGG 0: 1
1: 0
2: 3
3: 26
4: 218
1065928563_1065928583 11 Left 1065928563 10:30458219-30458241 CCCTCCTACCTGTACATAGTAAG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1065928583 10:30458253-30458275 CAGGGCTGGGGGCGGCGGGGGGG 0: 1
1: 2
2: 35
3: 320
4: 2493
1065928563_1065928573 -2 Left 1065928563 10:30458219-30458241 CCCTCCTACCTGTACATAGTAAG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1065928573 10:30458240-30458262 AGTGGGGTTCAACCAGGGCTGGG 0: 1
1: 0
2: 2
3: 12
4: 167
1065928563_1065928585 13 Left 1065928563 10:30458219-30458241 CCCTCCTACCTGTACATAGTAAG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1065928585 10:30458255-30458277 GGGCTGGGGGCGGCGGGGGGGGG 0: 1
1: 10
2: 118
3: 956
4: 6190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065928563 Original CRISPR CTTACTATGTACAGGTAGGA GGG (reversed) Exonic
905480427 1:38258060-38258082 CTTACTGTGTACAGGTGCCAGGG - Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
910137326 1:83988033-83988055 ATTACTATATGGAGGTAGGAGGG - Intronic
910767668 1:90798598-90798620 CTTACTATGGACAGGCACAAGGG - Intergenic
915997449 1:160577722-160577744 CTTACTATATTCAGGTACCATGG + Intronic
918350022 1:183645310-183645332 CTTAGTAAGTACAGGGAGAATGG - Intronic
918754378 1:188318770-188318792 CTGACTATGTCTAAGTAGGAAGG - Intergenic
921420391 1:214940641-214940663 CTTAGTATGTACAGGGAACATGG + Intergenic
922222071 1:223616251-223616273 CTTACTAGGCACAGTTTGGATGG - Intronic
1065705855 10:28471040-28471062 CTTTCTTTGTAAAGGCAGGAGGG + Intergenic
1065928563 10:30458219-30458241 CTTACTATGTACAGGTAGGAGGG - Exonic
1068737005 10:60425159-60425181 CTTTGTATATTCAGGTAGGAAGG + Intronic
1072337596 10:94412656-94412678 CTTAGTATGTTGTGGTAGGAAGG + Intronic
1073373630 10:103013437-103013459 CTTACTGTGCACTGGAAGGAAGG + Intronic
1074498156 10:113997881-113997903 CTTACTATATACAGAATGGATGG + Intergenic
1074550524 10:114438190-114438212 CTTACTATGTATTGGGATGAAGG + Intronic
1074798949 10:116979397-116979419 CTTACTAGGTTGAGGTAGGGTGG + Intronic
1080183979 11:29457360-29457382 ATTATAATGTTCAGGTAGGATGG - Intergenic
1080267188 11:30413807-30413829 CACAATATTTACAGGTAGGAGGG + Intronic
1080910517 11:36593459-36593481 CTTATTCTGTACAGGTTGGCAGG + Exonic
1083590331 11:63889904-63889926 CTTACTATAAGCAGGGAGGATGG + Intronic
1086726396 11:90189816-90189838 CTTACTATGTACTGAGGGGAAGG + Intronic
1087646582 11:100814880-100814902 CTTAGTATGTACAGATATGTAGG + Intronic
1092550990 12:9499507-9499529 CTTAAAATGTACATGTAGGGTGG + Intergenic
1094042381 12:26131729-26131751 TTTACTATGGACAGGTATTAAGG + Intronic
1098729441 12:74014684-74014706 CCCACTATGTACAGGCAGCATGG + Intergenic
1098769211 12:74532214-74532236 CTTACTAACTACAGGTAGCTTGG + Intergenic
1100269529 12:93011432-93011454 CTTACAATGGGCAGGTAGAAAGG + Intergenic
1100471572 12:94898178-94898200 CTTACTATGCACAGGGTGCATGG - Intronic
1103978927 12:124723358-124723380 CTTGCTATTTGCAGTTAGGAGGG - Intergenic
1104992220 12:132632159-132632181 CTTACCATGCACAGGTATGTCGG + Intronic
1107315269 13:39124797-39124819 CCTACTAGTTAGAGGTAGGAAGG - Intergenic
1110282703 13:73713982-73714004 TTCACTATCTACTGGTAGGATGG + Intronic
1110580816 13:77122766-77122788 ATTGCAATTTACAGGTAGGAAGG - Intronic
1111293363 13:86196860-86196882 CTTACTATGTACATGGAATATGG + Intergenic
1113920865 13:113908560-113908582 CTTTCGATGTACAGCCAGGAGGG + Intergenic
1120793011 14:88602597-88602619 CTTAGTAAGTACAGGCTGGAGGG + Intronic
1120919300 14:89740345-89740367 CTAGCTGTTTACAGGTAGGAAGG + Intergenic
1121626241 14:95387387-95387409 ATTACTATGTTCAGGAAGGTGGG + Intergenic
1122449659 14:101795421-101795443 CTTACAATGAACAGGTCTGAGGG - Intronic
1127291909 15:57578954-57578976 CTGACTATGGACAGCTGGGAAGG - Intergenic
1127560373 15:60130380-60130402 CATAATTTGTAAAGGTAGGAAGG - Intergenic
1127866059 15:63034009-63034031 CTTCCTTTGAAGAGGTAGGAGGG - Intergenic
1131428544 15:92367585-92367607 CCTAAAATGTACAGCTAGGATGG + Intergenic
1137008610 16:35301443-35301465 GATTCTATGTACAAGTAGGATGG - Intergenic
1137015308 16:35368343-35368365 GATTCTATGCACAGGTAGGATGG - Intergenic
1137054923 16:35740427-35740449 CAGACTGTATACAGGTAGGAAGG + Intergenic
1138331077 16:56215877-56215899 CTTACTGTATACAGGTGAGAGGG + Intronic
1140085183 16:71789270-71789292 CTCACTTTGGACAGGTAGGCTGG - Exonic
1144174586 17:12692839-12692861 ATTGCTATGTACAGATAGGTGGG - Intronic
1148904549 17:50903890-50903912 TTTACAATGTATGGGTAGGACGG - Intergenic
1155575571 18:27242455-27242477 GTTACTGTGTATAGGGAGGAGGG - Intergenic
925886134 2:8394905-8394927 CATGCTATGTAGAGGTAGGCAGG - Intergenic
929181955 2:39050422-39050444 CTTACTATGTGAAGGTAGATAGG + Intronic
933220462 2:79681763-79681785 CTTATTATGTACAAGTAACATGG + Intronic
935726752 2:106030406-106030428 CATGCCATGTACAGGAAGGATGG + Intergenic
939386311 2:141503518-141503540 CATTCTATGTACAGGTAGAATGG - Intronic
940611616 2:155999782-155999804 CTTATTATGTACAGGTCTGGAGG - Intergenic
942781535 2:179648677-179648699 CTTACTGTGAACAGATAGCAAGG + Intronic
945770595 2:214036697-214036719 CTTACAATGTACAGAAAGTAGGG + Intronic
1172322184 20:34004162-34004184 CTTCCTTTGTACATGGAGGAGGG + Intronic
1172454487 20:35057409-35057431 CTTACTATTAAGAGTTAGGAAGG + Intronic
1177071632 21:16516350-16516372 CTTATTATGTACATGGAGAAAGG + Intergenic
1177572492 21:22904957-22904979 CTTACTTTCTATAGGTAGGGTGG + Intergenic
1180057921 21:45368572-45368594 CTTATTCTGCACAGGGAGGACGG + Intergenic
951072461 3:18347700-18347722 CTTAATAAGTAGAGATAGGATGG - Intronic
953098786 3:39806027-39806049 CTTACTATGTACCAGTCGGGAGG + Intergenic
957216212 3:77323224-77323246 TTGAGTATGTAAAGGTAGGAGGG - Intronic
969244312 4:5922625-5922647 CTTACCATCTACAGGTGAGATGG - Intronic
974635463 4:64558781-64558803 CTTAATATTTACAGGGAGGGAGG - Intergenic
980450923 4:132970724-132970746 ATTACTATTTATAGATAGGATGG + Intergenic
981894758 4:149785171-149785193 GTTGCTATGAACAGGTATGAAGG - Intergenic
982312930 4:154004417-154004439 CTTTCTATGTACAGGTATTTGGG + Intergenic
983168848 4:164512959-164512981 ATTACTATGCACAAGAAGGAGGG + Intergenic
985631279 5:1015323-1015345 CTTCCTCTCTACAGGAAGGACGG - Intronic
985865168 5:2508909-2508931 CTTACTATGTCCAGTTACGCAGG + Intergenic
988100039 5:26663461-26663483 CCTACTATGTTCAGGCAGAATGG + Intergenic
988309819 5:29542490-29542512 CTTACTATGTTCAGTTTGGTGGG + Intergenic
988382924 5:30522327-30522349 CTTCCTAAGTACATCTAGGAGGG + Intergenic
996490445 5:124088449-124088471 TTTACTTTGTAAAAGTAGGAGGG - Intergenic
997417156 5:133737949-133737971 TTTACTGTGTGCAGGAAGGAGGG + Intergenic
998659518 5:144220597-144220619 CTTACTATATACATGTATGTAGG + Intronic
1000578005 5:162999970-162999992 ATTACGATGGAAAGGTAGGAAGG + Intergenic
1009899971 6:69798281-69798303 CTTATTCTGTCCAGGCAGGAAGG - Intergenic
1015189313 6:130456050-130456072 CTTACAAAGTACAGATAGGATGG + Intergenic
1018924597 6:168197527-168197549 CTCACCATGTTCAGGTAGCACGG - Intergenic
1021083567 7:16392244-16392266 CTTACTCTGTAGGGGTATGATGG - Intronic
1023145988 7:37151488-37151510 CTGAATATTTACAGGTCGGAAGG - Intronic
1023518509 7:41027452-41027474 CTTACATTGTATTGGTAGGAGGG + Intergenic
1027800749 7:82746240-82746262 CTATCTTGGTACAGGTAGGAGGG - Intergenic
1028752749 7:94400087-94400109 CTTTCTATGTGCAAGTAGGGTGG - Intronic
1030329619 7:108257206-108257228 CTGACTATAAACAGGCAGGAGGG + Intronic
1031835338 7:126674776-126674798 CTTACTATGTACAAATCTGACGG - Intronic
1035087457 7:156272995-156273017 GTTACTCTGTAAAGGGAGGAAGG - Intergenic
1036197475 8:6732792-6732814 CCCTCTATGTACAGGTAGGCAGG + Intronic
1036567395 8:9949158-9949180 CTTTCTATGGGCAGGAAGGAAGG - Intergenic
1039556620 8:38480844-38480866 CTTACTATGAGCAGGTACTATGG + Intergenic
1041185435 8:55295469-55295491 CTTACTATGTGCTGGTAGCAGGG + Intronic
1042453875 8:68977520-68977542 CAGACTGTGTACAGGTGGGAAGG - Intergenic
1044158048 8:88874988-88875010 CTTACTAAGTAAAGATAAGATGG + Intergenic
1048549332 8:135419481-135419503 CCTATTATGTACAGGAAGAAGGG + Intergenic
1049127810 8:140808229-140808251 ATTACCATGAACAGGTAAGATGG + Intronic
1050807366 9:9698150-9698172 CTTACTTTGTACACTTCGGAAGG + Intronic
1052586812 9:30439897-30439919 TTTACTCTAAACAGGTAGGAGGG - Intergenic
1056913540 9:90725361-90725383 CTCACTGTCTACAGGAAGGAGGG - Intergenic
1060215305 9:121735404-121735426 CCTACTGTGTACAGGCAGGCAGG - Intronic
1062071121 9:134555553-134555575 CTTACCATGTTCTGGAAGGAAGG + Intergenic
1194455931 X:94103159-94103181 CGTACGAGGTACAGGTATGATGG + Intergenic
1197137527 X:123080423-123080445 CTTATTTTGTACAAGTATGAAGG - Intergenic
1199700475 X:150371805-150371827 CTAACTATGTACAGGTGCAATGG - Intronic