ID: 1065928674

View in Genome Browser
Species Human (GRCh38)
Location 10:30459124-30459146
Sequence GGCTGAACTGCATTCGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065928674 Original CRISPR GGCTGAACTGCATTCGTTGC AGG Intronic