ID: 1065928674

View in Genome Browser
Species Human (GRCh38)
Location 10:30459124-30459146
Sequence GGCTGAACTGCATTCGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065928674 Original CRISPR GGCTGAACTGCATTCGTTGC AGG Intronic
902512217 1:16972625-16972647 GGCTGGACTGCAGGTGTTGCTGG - Exonic
919669300 1:200324331-200324353 GGCTGAACTCAGTTCCTTGCAGG - Intergenic
920447842 1:206033389-206033411 TGGTGAACTGCATTCCTTTCTGG + Intergenic
922243710 1:223774481-223774503 TGCTGAACACCATTGGTTGCAGG + Intronic
1065685456 10:28280099-28280121 TGCTGAACTGAATTCCTGGCTGG - Exonic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1077478993 11:2804167-2804189 GGGTGAACTGCAGTTGTTTCTGG - Intronic
1084530266 11:69723169-69723191 GGGTGAACTGCACTGGGTGCAGG + Intergenic
1089615444 11:119692285-119692307 GGCTGAGCTGCATCCGCAGCTGG - Intronic
1095445689 12:42279850-42279872 GGCAGAACTGAATTCCTTGCAGG + Intronic
1095923035 12:47550111-47550133 GGCTGCACTGCATTCCATCCTGG + Intergenic
1099232934 12:80049038-80049060 GGCTGGACTGCATTCTTACCTGG + Intergenic
1100683134 12:96951948-96951970 GAATGAAATGCATTCTTTGCTGG + Exonic
1103648076 12:122410972-122410994 AGCTGAACCTCATTCATTGCTGG + Intronic
1121272071 14:92644439-92644461 GGAAGAACTGCATTCCTTTCTGG + Intronic
1126525864 15:49653401-49653423 AGCTGAACTGCATTCCTTTCTGG - Exonic
1129523874 15:76202001-76202023 GGCTGGACTGCACTGGGTGCTGG - Intronic
1131424440 15:92334153-92334175 GGCAGAGCTGCATTCGTAACTGG - Intergenic
1144872801 17:18381162-18381184 GGCTCAACTTCCTTCTTTGCTGG + Intronic
1147183754 17:38702912-38702934 GGCTGGGCTGGATTCGTGGCGGG - Intergenic
1147192538 17:38746516-38746538 AGCTGAACTGCTTTTGTTGCTGG - Intronic
1148461852 17:47843579-47843601 CGCTGACCTGCATTCTTAGCAGG - Intergenic
1152694936 17:81739296-81739318 GGTGGAGCTGCATTCGTTTCCGG + Intergenic
1154170744 18:12048328-12048350 GGCTGCACTGCCTTCATTGGAGG - Intergenic
1154964370 18:21341923-21341945 AGCTGAACTGCTTTTGTTGGTGG + Intronic
1157328021 18:46682920-46682942 TGCAGAACTGCATTCCTTTCTGG - Intronic
926081187 2:9987709-9987731 GGCTGAGCTGGATTCAATGCAGG + Intronic
927509001 2:23632625-23632647 AGCAGAAGTGCATTTGTTGCGGG - Intronic
936434708 2:112494237-112494259 GGCTGAATTCCATTCTGTGCTGG - Exonic
938630416 2:133160642-133160664 GGCTGAAGAGCTTTCGATGCTGG - Intronic
946336216 2:219038405-219038427 GGCTGCACTGCTGTCGTTGATGG + Exonic
948060645 2:235041371-235041393 GGCTGAGCTGGATTCGGTGAAGG - Exonic
1176313120 21:5165169-5165191 GGCAAATCTGCATTCTTTGCTGG - Intergenic
1179843928 21:44096861-44096883 GGCAAATCTGCATTCTTTGCTGG + Intronic
1184889850 22:47373008-47373030 TGCTGAACTGTATTCCATGCTGG - Intergenic
949234044 3:1787067-1787089 GGCTGAGCTGCATTTTTTTCTGG + Intergenic
954977702 3:54712307-54712329 AGCTGAACTGTATTCCTTTCTGG + Intronic
956012597 3:64847187-64847209 GGGTGCTGTGCATTCGTTGCAGG - Intergenic
956501985 3:69896862-69896884 GGCTGAACTGCAATGTTTGAAGG - Intronic
974951498 4:68588577-68588599 GGCTGAAATTCATTGATTGCTGG - Intronic
987394205 5:17406426-17406448 GGCAGAATTGCATTCATGGCAGG - Intergenic
988183440 5:27828551-27828573 GGCAAAGCTGCATTCCTTGCTGG - Intergenic
989114515 5:37939452-37939474 GGCTGAACAGAATTCCTTTCTGG + Intergenic
1005153084 6:22775205-22775227 GGCTGACCTGGATTCCTTCCAGG + Intergenic
1008881553 6:56385354-56385376 GGCAGAGCTGCATTCCTTTCTGG + Intronic
1012606071 6:101158862-101158884 GGTTGAACTAAATTAGTTGCAGG + Intergenic
1018154504 6:160973303-160973325 GGCTGGACTGCATTCCCTGGGGG - Intergenic
1022658898 7:32347815-32347837 GGCTGGACTGCATTCTTATCTGG - Intergenic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1026987723 7:74565152-74565174 GGCTGAACGCCATTGGTAGCTGG + Intronic
1029699179 7:102235296-102235318 GGCTGAACTGCATCCCTTAGGGG + Intronic
1031398270 7:121300270-121300292 GGCTGCACTGCATTCAGTGTTGG - Intergenic
1033183581 7:139204286-139204308 GGCAGGACTGCATTCCTTTCTGG - Intergenic
1037072070 8:14663040-14663062 GGCAGAACTGCATTTCTTTCTGG - Intronic
1051281313 9:15444049-15444071 GGCTGAACTGGTTTAGATGCAGG - Intronic
1055062282 9:72082263-72082285 GGCAGAACTGACTTCTTTGCGGG + Intergenic
1055275407 9:74610472-74610494 GGCTGGACTGAATGCTTTGCAGG + Intronic
1056453269 9:86737020-86737042 GGCTGAAAGGCCTTGGTTGCTGG + Intergenic
1057026055 9:91734425-91734447 GATTGAACTGCATTCGTGGGTGG - Intronic
1189224021 X:39397729-39397751 GGCTGCTCTGCATTGGCTGCCGG + Intergenic
1192851748 X:74963841-74963863 GGCTGAGGTGCATTCCTTTCTGG + Intergenic
1194581980 X:95684595-95684617 GGCAGAGCTGCATTCCTTTCTGG - Intergenic
1195479881 X:105332252-105332274 GGTTCACCTGCATTTGTTGCTGG + Intronic
1199704421 X:150411517-150411539 GGCTGAACTGGACTTGCTGCTGG - Intronic