ID: 1065933741

View in Genome Browser
Species Human (GRCh38)
Location 10:30501918-30501940
Sequence GAAAAATCACAGAAGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065933741_1065933745 7 Left 1065933741 10:30501918-30501940 CCCAGCTTCTTCTGTGATTTTTC No data
Right 1065933745 10:30501948-30501970 ATATTTTGACTCCTAGGAGGTGG No data
1065933741_1065933746 17 Left 1065933741 10:30501918-30501940 CCCAGCTTCTTCTGTGATTTTTC No data
Right 1065933746 10:30501958-30501980 TCCTAGGAGGTGGCATTCATTGG No data
1065933741_1065933743 1 Left 1065933741 10:30501918-30501940 CCCAGCTTCTTCTGTGATTTTTC No data
Right 1065933743 10:30501942-30501964 AATACTATATTTTGACTCCTAGG No data
1065933741_1065933744 4 Left 1065933741 10:30501918-30501940 CCCAGCTTCTTCTGTGATTTTTC No data
Right 1065933744 10:30501945-30501967 ACTATATTTTGACTCCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065933741 Original CRISPR GAAAAATCACAGAAGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr