ID: 1065934200

View in Genome Browser
Species Human (GRCh38)
Location 10:30506105-30506127
Sequence ATCAAAGCACAGAGAGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065934200_1065934203 22 Left 1065934200 10:30506105-30506127 CCTTACCCTCTCTGTGCTTTGAT No data
Right 1065934203 10:30506150-30506172 ATGATAATACAGCTGCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065934200 Original CRISPR ATCAAAGCACAGAGAGGGTA AGG (reversed) Intergenic
No off target data available for this crispr