ID: 1065935183

View in Genome Browser
Species Human (GRCh38)
Location 10:30514973-30514995
Sequence TGTTTGGTCTGGAGGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065935183_1065935196 30 Left 1065935183 10:30514973-30514995 CCTCCTGGCCTCCAGACCAAACA No data
Right 1065935196 10:30515026-30515048 GGAGTGTGCTACCCTTGCTAAGG No data
1065935183_1065935191 8 Left 1065935183 10:30514973-30514995 CCTCCTGGCCTCCAGACCAAACA No data
Right 1065935191 10:30515004-30515026 AAATCCCAGTGTGACCTAACTGG No data
1065935183_1065935192 9 Left 1065935183 10:30514973-30514995 CCTCCTGGCCTCCAGACCAAACA No data
Right 1065935192 10:30515005-30515027 AATCCCAGTGTGACCTAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065935183 Original CRISPR TGTTTGGTCTGGAGGCCAGG AGG (reversed) Intergenic
No off target data available for this crispr