ID: 1065935184

View in Genome Browser
Species Human (GRCh38)
Location 10:30514976-30514998
Sequence TGGTGTTTGGTCTGGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065935184_1065935192 6 Left 1065935184 10:30514976-30514998 CCTGGCCTCCAGACCAAACACCA No data
Right 1065935192 10:30515005-30515027 AATCCCAGTGTGACCTAACTGGG No data
1065935184_1065935197 28 Left 1065935184 10:30514976-30514998 CCTGGCCTCCAGACCAAACACCA No data
Right 1065935197 10:30515027-30515049 GAGTGTGCTACCCTTGCTAAGGG No data
1065935184_1065935196 27 Left 1065935184 10:30514976-30514998 CCTGGCCTCCAGACCAAACACCA No data
Right 1065935196 10:30515026-30515048 GGAGTGTGCTACCCTTGCTAAGG No data
1065935184_1065935191 5 Left 1065935184 10:30514976-30514998 CCTGGCCTCCAGACCAAACACCA No data
Right 1065935191 10:30515004-30515026 AAATCCCAGTGTGACCTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065935184 Original CRISPR TGGTGTTTGGTCTGGAGGCC AGG (reversed) Intergenic
No off target data available for this crispr