ID: 1065935188

View in Genome Browser
Species Human (GRCh38)
Location 10:30514984-30515006
Sequence TTTCACCCTGGTGTTTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065935188_1065935191 -3 Left 1065935188 10:30514984-30515006 CCAGACCAAACACCAGGGTGAAA No data
Right 1065935191 10:30515004-30515026 AAATCCCAGTGTGACCTAACTGG No data
1065935188_1065935192 -2 Left 1065935188 10:30514984-30515006 CCAGACCAAACACCAGGGTGAAA No data
Right 1065935192 10:30515005-30515027 AATCCCAGTGTGACCTAACTGGG No data
1065935188_1065935197 20 Left 1065935188 10:30514984-30515006 CCAGACCAAACACCAGGGTGAAA No data
Right 1065935197 10:30515027-30515049 GAGTGTGCTACCCTTGCTAAGGG No data
1065935188_1065935196 19 Left 1065935188 10:30514984-30515006 CCAGACCAAACACCAGGGTGAAA No data
Right 1065935196 10:30515026-30515048 GGAGTGTGCTACCCTTGCTAAGG No data
1065935188_1065935198 26 Left 1065935188 10:30514984-30515006 CCAGACCAAACACCAGGGTGAAA No data
Right 1065935198 10:30515033-30515055 GCTACCCTTGCTAAGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065935188 Original CRISPR TTTCACCCTGGTGTTTGGTC TGG (reversed) Intergenic
No off target data available for this crispr