ID: 1065935190

View in Genome Browser
Species Human (GRCh38)
Location 10:30514996-30515018
Sequence GTCACACTGGGATTTCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065935190_1065935196 7 Left 1065935190 10:30514996-30515018 CCAGGGTGAAATCCCAGTGTGAC No data
Right 1065935196 10:30515026-30515048 GGAGTGTGCTACCCTTGCTAAGG No data
1065935190_1065935198 14 Left 1065935190 10:30514996-30515018 CCAGGGTGAAATCCCAGTGTGAC No data
Right 1065935198 10:30515033-30515055 GCTACCCTTGCTAAGGGAGAAGG No data
1065935190_1065935197 8 Left 1065935190 10:30514996-30515018 CCAGGGTGAAATCCCAGTGTGAC No data
Right 1065935197 10:30515027-30515049 GAGTGTGCTACCCTTGCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065935190 Original CRISPR GTCACACTGGGATTTCACCC TGG (reversed) Intergenic
No off target data available for this crispr