ID: 1065935192

View in Genome Browser
Species Human (GRCh38)
Location 10:30515005-30515027
Sequence AATCCCAGTGTGACCTAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065935183_1065935192 9 Left 1065935183 10:30514973-30514995 CCTCCTGGCCTCCAGACCAAACA No data
Right 1065935192 10:30515005-30515027 AATCCCAGTGTGACCTAACTGGG No data
1065935187_1065935192 1 Left 1065935187 10:30514981-30515003 CCTCCAGACCAAACACCAGGGTG No data
Right 1065935192 10:30515005-30515027 AATCCCAGTGTGACCTAACTGGG No data
1065935188_1065935192 -2 Left 1065935188 10:30514984-30515006 CCAGACCAAACACCAGGGTGAAA No data
Right 1065935192 10:30515005-30515027 AATCCCAGTGTGACCTAACTGGG No data
1065935184_1065935192 6 Left 1065935184 10:30514976-30514998 CCTGGCCTCCAGACCAAACACCA No data
Right 1065935192 10:30515005-30515027 AATCCCAGTGTGACCTAACTGGG No data
1065935182_1065935192 10 Left 1065935182 10:30514972-30514994 CCCTCCTGGCCTCCAGACCAAAC No data
Right 1065935192 10:30515005-30515027 AATCCCAGTGTGACCTAACTGGG No data
1065935189_1065935192 -7 Left 1065935189 10:30514989-30515011 CCAAACACCAGGGTGAAATCCCA No data
Right 1065935192 10:30515005-30515027 AATCCCAGTGTGACCTAACTGGG No data
1065935181_1065935192 20 Left 1065935181 10:30514962-30514984 CCTTCACTTTCCCTCCTGGCCTC No data
Right 1065935192 10:30515005-30515027 AATCCCAGTGTGACCTAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065935192 Original CRISPR AATCCCAGTGTGACCTAACT GGG Intergenic
No off target data available for this crispr