ID: 1065935196

View in Genome Browser
Species Human (GRCh38)
Location 10:30515026-30515048
Sequence GGAGTGTGCTACCCTTGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065935194_1065935196 -6 Left 1065935194 10:30515009-30515031 CCAGTGTGACCTAACTGGGAGTG No data
Right 1065935196 10:30515026-30515048 GGAGTGTGCTACCCTTGCTAAGG No data
1065935183_1065935196 30 Left 1065935183 10:30514973-30514995 CCTCCTGGCCTCCAGACCAAACA No data
Right 1065935196 10:30515026-30515048 GGAGTGTGCTACCCTTGCTAAGG No data
1065935184_1065935196 27 Left 1065935184 10:30514976-30514998 CCTGGCCTCCAGACCAAACACCA No data
Right 1065935196 10:30515026-30515048 GGAGTGTGCTACCCTTGCTAAGG No data
1065935187_1065935196 22 Left 1065935187 10:30514981-30515003 CCTCCAGACCAAACACCAGGGTG No data
Right 1065935196 10:30515026-30515048 GGAGTGTGCTACCCTTGCTAAGG No data
1065935193_1065935196 -5 Left 1065935193 10:30515008-30515030 CCCAGTGTGACCTAACTGGGAGT No data
Right 1065935196 10:30515026-30515048 GGAGTGTGCTACCCTTGCTAAGG No data
1065935189_1065935196 14 Left 1065935189 10:30514989-30515011 CCAAACACCAGGGTGAAATCCCA No data
Right 1065935196 10:30515026-30515048 GGAGTGTGCTACCCTTGCTAAGG No data
1065935190_1065935196 7 Left 1065935190 10:30514996-30515018 CCAGGGTGAAATCCCAGTGTGAC No data
Right 1065935196 10:30515026-30515048 GGAGTGTGCTACCCTTGCTAAGG No data
1065935188_1065935196 19 Left 1065935188 10:30514984-30515006 CCAGACCAAACACCAGGGTGAAA No data
Right 1065935196 10:30515026-30515048 GGAGTGTGCTACCCTTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065935196 Original CRISPR GGAGTGTGCTACCCTTGCTA AGG Intergenic
No off target data available for this crispr