ID: 1065935197

View in Genome Browser
Species Human (GRCh38)
Location 10:30515027-30515049
Sequence GAGTGTGCTACCCTTGCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065935193_1065935197 -4 Left 1065935193 10:30515008-30515030 CCCAGTGTGACCTAACTGGGAGT No data
Right 1065935197 10:30515027-30515049 GAGTGTGCTACCCTTGCTAAGGG No data
1065935190_1065935197 8 Left 1065935190 10:30514996-30515018 CCAGGGTGAAATCCCAGTGTGAC No data
Right 1065935197 10:30515027-30515049 GAGTGTGCTACCCTTGCTAAGGG No data
1065935184_1065935197 28 Left 1065935184 10:30514976-30514998 CCTGGCCTCCAGACCAAACACCA No data
Right 1065935197 10:30515027-30515049 GAGTGTGCTACCCTTGCTAAGGG No data
1065935189_1065935197 15 Left 1065935189 10:30514989-30515011 CCAAACACCAGGGTGAAATCCCA No data
Right 1065935197 10:30515027-30515049 GAGTGTGCTACCCTTGCTAAGGG No data
1065935194_1065935197 -5 Left 1065935194 10:30515009-30515031 CCAGTGTGACCTAACTGGGAGTG No data
Right 1065935197 10:30515027-30515049 GAGTGTGCTACCCTTGCTAAGGG No data
1065935188_1065935197 20 Left 1065935188 10:30514984-30515006 CCAGACCAAACACCAGGGTGAAA No data
Right 1065935197 10:30515027-30515049 GAGTGTGCTACCCTTGCTAAGGG No data
1065935187_1065935197 23 Left 1065935187 10:30514981-30515003 CCTCCAGACCAAACACCAGGGTG No data
Right 1065935197 10:30515027-30515049 GAGTGTGCTACCCTTGCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065935197 Original CRISPR GAGTGTGCTACCCTTGCTAA GGG Intergenic
No off target data available for this crispr