ID: 1065935198

View in Genome Browser
Species Human (GRCh38)
Location 10:30515033-30515055
Sequence GCTACCCTTGCTAAGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065935189_1065935198 21 Left 1065935189 10:30514989-30515011 CCAAACACCAGGGTGAAATCCCA No data
Right 1065935198 10:30515033-30515055 GCTACCCTTGCTAAGGGAGAAGG No data
1065935194_1065935198 1 Left 1065935194 10:30515009-30515031 CCAGTGTGACCTAACTGGGAGTG No data
Right 1065935198 10:30515033-30515055 GCTACCCTTGCTAAGGGAGAAGG No data
1065935195_1065935198 -8 Left 1065935195 10:30515018-30515040 CCTAACTGGGAGTGTGCTACCCT No data
Right 1065935198 10:30515033-30515055 GCTACCCTTGCTAAGGGAGAAGG No data
1065935187_1065935198 29 Left 1065935187 10:30514981-30515003 CCTCCAGACCAAACACCAGGGTG No data
Right 1065935198 10:30515033-30515055 GCTACCCTTGCTAAGGGAGAAGG No data
1065935188_1065935198 26 Left 1065935188 10:30514984-30515006 CCAGACCAAACACCAGGGTGAAA No data
Right 1065935198 10:30515033-30515055 GCTACCCTTGCTAAGGGAGAAGG No data
1065935193_1065935198 2 Left 1065935193 10:30515008-30515030 CCCAGTGTGACCTAACTGGGAGT No data
Right 1065935198 10:30515033-30515055 GCTACCCTTGCTAAGGGAGAAGG No data
1065935190_1065935198 14 Left 1065935190 10:30514996-30515018 CCAGGGTGAAATCCCAGTGTGAC No data
Right 1065935198 10:30515033-30515055 GCTACCCTTGCTAAGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065935198 Original CRISPR GCTACCCTTGCTAAGGGAGA AGG Intergenic
No off target data available for this crispr