ID: 1065940920

View in Genome Browser
Species Human (GRCh38)
Location 10:30563302-30563324
Sequence CACAATTATTGGATGGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065940917_1065940920 -6 Left 1065940917 10:30563285-30563307 CCAGGGGTGAGAGGGTACACAAT No data
Right 1065940920 10:30563302-30563324 CACAATTATTGGATGGAGCCCGG No data
1065940916_1065940920 1 Left 1065940916 10:30563278-30563300 CCTACTACCAGGGGTGAGAGGGT No data
Right 1065940920 10:30563302-30563324 CACAATTATTGGATGGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065940920 Original CRISPR CACAATTATTGGATGGAGCC CGG Intergenic
No off target data available for this crispr