ID: 1065942061

View in Genome Browser
Species Human (GRCh38)
Location 10:30573832-30573854
Sequence CAGCTGAGCCTTCTATTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065942058_1065942061 -8 Left 1065942058 10:30573817-30573839 CCTACTCTGGCCACTCAGCTGAG No data
Right 1065942061 10:30573832-30573854 CAGCTGAGCCTTCTATTCATGGG No data
1065942055_1065942061 10 Left 1065942055 10:30573799-30573821 CCAGGTCAGTGCCAACGGCCTAC No data
Right 1065942061 10:30573832-30573854 CAGCTGAGCCTTCTATTCATGGG No data
1065942057_1065942061 -1 Left 1065942057 10:30573810-30573832 CCAACGGCCTACTCTGGCCACTC No data
Right 1065942061 10:30573832-30573854 CAGCTGAGCCTTCTATTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065942061 Original CRISPR CAGCTGAGCCTTCTATTCAT GGG Intergenic
No off target data available for this crispr