ID: 1065944541

View in Genome Browser
Species Human (GRCh38)
Location 10:30594827-30594849
Sequence GCTTCTGCACTGAAGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065944541_1065944547 6 Left 1065944541 10:30594827-30594849 CCCTTTTCCTTCAGTGCAGAAGC No data
Right 1065944547 10:30594856-30594878 CCTTCCCTGGTGTGCCAACCCGG No data
1065944541_1065944545 -7 Left 1065944541 10:30594827-30594849 CCCTTTTCCTTCAGTGCAGAAGC No data
Right 1065944545 10:30594843-30594865 CAGAAGCTGGCATCCTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065944541 Original CRISPR GCTTCTGCACTGAAGGAAAA GGG (reversed) Intergenic
No off target data available for this crispr