ID: 1065944899

View in Genome Browser
Species Human (GRCh38)
Location 10:30597344-30597366
Sequence CAGTGTAACCAGCAGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065944892_1065944899 10 Left 1065944892 10:30597311-30597333 CCGAGGGTTTACAGGGTGTTTCT No data
Right 1065944899 10:30597344-30597366 CAGTGTAACCAGCAGGAGTTGGG No data
1065944891_1065944899 11 Left 1065944891 10:30597310-30597332 CCCGAGGGTTTACAGGGTGTTTC No data
Right 1065944899 10:30597344-30597366 CAGTGTAACCAGCAGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065944899 Original CRISPR CAGTGTAACCAGCAGGAGTT GGG Intergenic
No off target data available for this crispr